After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human AKR1C2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AKR1C2 cDNA Clone Product Information
Gene_bank_ref_id:BC007024
RefSeq ORF Size:972bp
cDNA Description:Full length Clone DNA of Homo sapiens aldo-keto reductase family 1, member C2 with N terminal HA tag.
Gene Synonym:AKR1C-pseudo, BABP, DD, DD2, DDH2, FLJ53800, HAKRD, HBAB, MCDR2, SRXY8, AKR1C2
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

AKR1C2 is a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols using NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme binds bile acid with high affinity, and shows minimal 3-alpha-hydroxysteroid dehydrogenase activity. AKR1C2 gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding two different isoforms have been found for AKR1C2 gene.

References
  • Jin Y. et al., 2011, Biochem J. 437 (1): 53-61.
  • Veilleux A. et al., 2012, Am J Physiol Endocrinol Metab. 302 (8): E941-9.
  • Kuang P. et al., 2012, Lung Cancer. 77 (2): 427-32.
  • Size / Price
    Catalog: HG14175-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"