Quick Order

Rat NINJ1 / Ninjurin1 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat NINJ1 cDNA Clone Product Information
Gene_bank_ref_id:NM_012867.1
RefSeq ORF Size:459bp
cDNA Description:Full length Clone DNA of Rattus norvegicus ninjurin 1 with N terminal Flag tag.
Gene Synonym:Ninj1
Species:Rat
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Ninjurin-1, also known as NINJ1, is a member of the Ninjurin family of transmembrane (TM) proteins. It is expressed in CD19(+) CD10(+) B-cell progenitor cells and higher levels in B-lineage acute lymphoblastic leukemia cells. Ninjurin-1 is expressed also in a number of other adult and embryonic tissues, predominantly in epithelial cells. Its expression is upregulated after axotomy in neurons and in Schwann cells surrounding the distal nerve segment. Upregulated expression of ninjurin-1 has been identified as a marker of minimal residual disease in B-lineage acute lymphoblastic leukemia. It mediates homophilic adhesion, and promotes neurite extension of dorsal root ganglion neurons in vitro. Ninjurin-1 has been found to show a high expression level in the liver tissue of patients with hepatocellular carcinoma, and this seems to be associated with cases of cirrhosis and chronic viral hepatitis. It has been reported that NINJURIN increases p21 expression and induces cellular senescence in human hepatoma cells.

References
  • Cardoso CC, et al. (2007) Ninjurin 1 asp110ala single nucleotide polymorphism is associated with protection in leprosy nerve damage. J Neuroimmunol. 190 (1-2): 131-8.
  • Ifergan I, et al. (2011) Role of Ninjurin-1 in the migration of myeloid cells to central nervous system inflammatory lesions. Ann Neurol. 70 (5): 751-63.
  • Toyama T, et al. (2005) Ninjurin1 increases p21 expression and induces cellular senescence in human hepatoma cells. J Hepatol. 41 (4): 637-43.
  • Size / Price
    Catalog: RG80424-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"