Quick Order

Text Size:AAA

Human DAPK3 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DAPK3 cDNA Clone Product Information
RefSeq ORF Size:1365bp
cDNA Description:Full length Clone DNA of Homo sapiens death-associated protein kinase 3 with Flag tag.
Gene Synonym:ZIP, ZIPK, FLJ36473, DAPK3
Restriction Site:HindIII + XhoI (5.4kb + 1.42kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations 18 G/A and 324 A/G not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Death-associated protein kinase 3, also known as DAP kinase 3, ZIP-kinase, DAPK3 and ZIPK, is a nucleus and cytoplasm protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and DAP kinase subfamily. DAPK3 / ZIPK contains one protein kinase domain. It is a serine/threonine kinase which acts as a positive regulator of apoptosis. It phosphorylates histone H3 on 'Thr-11' at centromeres during mitosis. DAPK3 / ZIPK is a homodimer or forms heterodimers with ATF4. Both interactions require an intact leucine zipper domain and oligomerization is required for full enzymatic activity. It also binds to DAXX and PAWR, possibly in a ternary complex which plays a role in caspase activation. DAPK3 / ZIPK regulates myosin light chain phosphatase through phosphorylation of MYPT1 thereby regulating the assembly of the actin cytoskeleton, cell migration, invasiveness of tumor cells, smooth muscle contraction and neurite outgrowth. It is involved in the formation of promyelocytic leukemia protein nuclear body (PML-NB), one of many subnuclear domains in the eukaryotic cell nucleus, and which is involved in oncogenesis and viral infection.

  • Kawai T., et al., 1998, Mol. Cell. Biol. 18:1642-1651.
  • Murata-Hori M., et al., 1999, FEBS Lett. 451:81-84.
  • Kawai T., et al., 2003, Mol. Cell. Biol. 23:6174-6186.
  • Greenman C., et al., 2007, Nature 446:153-158.
  • Ohbayashi N., et al., 2008, Biochem. Biophys. Res. Commun. 372: 708 -712.
  • Size / Price
    Catalog: HG10757-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions