Quick Order

Text Size:AAA

Mouse EFNB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EFNB1cDNA Clone Product Information
cDNA Size:1038
cDNA Description:ORF Clone of Mus musculus Ephrin-B1 DNA.
Gene Synonym:Epl2, EFL-3, Elk-L, Eplg2, Lerk2, Stra1, Cek5-L, LERK-2, Efnb1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ephrin & Eph Receptor Related Products
Product nameProduct name
Cynomolgus EphB1 / EPHT2 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (His Tag, ECD)Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Mouse Ephrin B3 / EFNB3 Protein (His Tag)Mouse EphB6 Protein (His Tag)Human Ephrin-A3 / EFNA3 / EFL2 Protein (Fc Tag)Human Ephrin-A3 / EFNA3 Protein (His & Fc Tag)Human Ephrin-A3 / EFNA3 Protein (His Tag)Human Ephrin-A3 / EFNA3 ProteinHuman Ephrin-A5 / EFNA5 Protein (Fc Tag)Human Ephrin-A5 / EFNA5 Protein (His Tag)Human EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 Protein (His Tag)Human EphB6 / EphB6 ProteinHuman EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB4 / HTK ProteinHuman EphA1 / Eph Receptor A1 Protein (Fc Tag)Mouse Ephrin B3 / EFNB3 Protein (ECD, Fc Tag)Human EphB2 Protein (His & Fc Tag)Human EphB2 Protein (His Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Human EphB2 / Hek5 ProteinHuman Ephrin-B2 / EFNB2 Protein (His & Fc Tag)Human Ephrin-B2 / EFNB2 Protein (His Tag)Human Ephrin-B2 / EFNB2 ProteinHuman Ephrin-A1 / EFNA1 Protein (His & Fc Tag)Human Ephrin-A1 / EFNA1 Protein (His Tag)Human Ephrin-B1 / EFNB1 Protein (His & Fc Tag)Human Ephrin-B1 / EFNB1 Protein (His Tag)Human Ephrin-A4 / EFNA4 Protein (Fc Tag)Human EphA4 Protein (His & Fc Tag)Human EphA4 Protein (His Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Human EphA7 / EHK3 Protein (His Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Human EphB1 / EPHT2 Protein (His Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Human EphA2 Protein (His Tag)Human EphA2 Protein (aa 585-976, His & GST Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 ProteinMouse Ephrin-B1 / EFNB1 Protein (Fc Tag)Mouse Ephrin-B1 / EFNB1 Protein (His Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse EphA2 Protein (His Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse Ephrin-A1 / EFNA1 Protein (Fc Tag)Mouse Ephrin-A1 / EFNA1 Protein (His Tag)Mouse Ephrin-A3 / EFNA3 Protein (His Tag)Mouse Ephrin-A4 / EFNA4 Protein (Fc Tag)Mouse Ephrin-A4 / EFNA4 Protein (His Tag)Mouse Ephrin-A5 / EFNA5 Protein (Fc Tag)Mouse Ephrin-A5 / EFNA5 Protein (His Tag)Mouse Ephrin-B2 / EFNB2 Protein (Fc Tag)Mouse Ephrin-B2 / EFNB2 Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Mouse EphA1 / EPH receptor A1 Protein (His Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (Fc Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (His Tag)Canine Ephrin-A5 / EFNA5 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (His Tag)Rat Ephrin-A5 / EFNA5 Protein (Fc Tag)Rat Ephrin-A5 / EFNA5 Protein (His Tag)Rat Ephrin-B1 / EFNB1 Protein (Fc Tag)Rat Ephrin-B1 / EFNB1 Protein (His Tag)Rat Ephrin-B2 / EFNB2 Protein (Fc Tag)Rat Ephrin-B2 / EFNB2 Protein (His Tag)Rat EphA7 / EHK3 Protein (His Tag)Rat Ephrin-B3 / EFNB3 Protein (Fc Tag)Rat Ephrin-B3 / EFNB3 Protein (His Tag)Rat Ephrin-A1 / EFNA1 Protein (His Tag)Rat EphA4 Protein (Fc Tag) Rat EphA4 Protein (His Tag)Cynomolgus EphA4 Protein (Fc Tag)Cynomolgus EphA4 Protein (His Tag)Cynomolgus Ephrin-A5 / EFNA5 Protein (Fc Tag)Cynomolgus Ephrin-A5 / EFNA5 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Mouse EphB2 / Hek5 Protein (His Tag)Cynomolgus EphB1 / EPHT2 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (Fc Tag)

Ephrin-B1 also known as EFNB1, is a member of the ephrin family. The transmembrane- associated ephrin ligands and their Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Eph/ephrin interactions are implicated in axon guidance, neural crest cell migration, establishment of segmental boundaries, and formation of angiogenic capillary plexi. Eph receptors and ephrins are divided into two subclasses, A and B, based on binding specificities. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. EphrinB1 and B class Eph receptors provide positional cues required for the normal morphogenesis of skeletal elements. Another malformation, preaxial polydactyly, was exclusively seen in heterozygous females in which expression of the X-linked ephrinB1 gene was mosaic, so that ectopic EphB-ephrinB1 interactions led to restricted cell movements and the bifurcation of digital rays.

  • Davy A, et al. (2004) Ephrin-B1 forward and reverse signaling are required during mouse development. Genes Dev. 18(5): 572-83.
  • Compagni A, et al. (2003) Control of skeletal patterning by ephrinB1-EphB interactions. Dev Cell. 5(2): 217-30.
  • Wieland I, et al. (2004) Mutations of the ephrin-B1 gene cause craniofrontonasal syndrome. Am J Hum Genet. 74(6): 1209-15.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items