Quick Order

Rat JAG1 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat JAG1 cDNA Clone Product Information
Gene_bank_ref_id:NM_019147.1
RefSeq ORF Size:3660bp
cDNA Description:Full length Clone DNA of Rattus norvegicus jagged 1 with N terminal Flag tag.
Gene Synonym:Jag1
Species:Rat
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Protein Jagged 1, also known as JAG1, JAGL1 and CD339, is a single-pass type I  membrane protein which contains 1 DSL domain and 15 EGF-like domains. JAG1/Jagged 1 is widely expressed in adult and fetal tissues. The expression of JAG1/Jagged 1 is up-regulated in cervical squamous cell carcinoma. JAG1/Jagged 1 is also expressed in bone marrow cell line HS-27a which supports the long-term maintenance of immature progenitor cells. JAG1/Jagged 1 is a ligand for multiple Notch receptors. It is involved in the mediation of Notch signaling. JAG1/Jagged 1 may be involved in cell-fate decisions during hematopoiesis. 

JAG1/Jagged 1 seems to be involved in early and late stages of mammalian cardiovascular development. It inhibits myoblast differentiation and enhances fibroblast growth factor-induced angiogenesis. Defects in JAG1/Jagged 1 are the cause of Alagille syndrome type 1 (ALGS1). Alagille syndrome is an autosomal dominant multisystem disorder defined clinically by hepatic bile duct paucity and cholestasis in association with cardiac, skeletal, and ophthalmologic manifestations. Defects in JAG1/Jagged 1 are also a cause of tetralogy of Fallot (TOF). TOF is a congenital heart anomaly which consists of pulmonary stenosis, ventricular septal defect, dextroposition of the aorta (aorta is on the right side instead of the left) and hypertrophy of the right ventricle. This condition results in a blue baby at birth due to inadequate oxygenation.

References
  1. Oda T.et al., 1997, Nat. Genet. 16:235-242.
  2. Krantz I.D. et al., 1998, Am. J. Hum. Genet. 62:1361-1369.
  3. Li L. et al., 1998, Immunity. 8:43-55.
  4. Jones E.A. et al., 2000, J. Med. Genet. 37: 658-662.
  5. Roepke A.et al., 2003, Hum. Mutat. 21:100-100.
  6. Jurkiewicz D.et al., 2005, Hum. Mutat. 25:321-321.
  7. Warthen D.M.et al., 2006, Hum. Mutat. 27:436-443.
Size / Price
Catalog: RG80419-NF
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"