Quick Order

Text Size:AAA

Mouse CDK5 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CDK5 cDNA Clone Product Information
NCBI RefSeq:NM_007668.3
RefSeq ORF Size:879bp
cDNA Description:Full length Clone DNA of Mus musculus cyclin-dependent kinase 5 with C terminal His tag.
Gene Synonym:Crk6, AW048668, Cdk5
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Cell division protein kinase 5, also known as Cyclin-dependent kinase 5, Serine/threonine-protein kinase PSSALRE, Tau protein kinase II catalytic subunit, TPKII catalytic subunit and CDK5, is a cytoplasm protein which belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family and CDC2 / CDKX subfamily. Cyclin-dependent kinases (Cdks) are a family of proline-directed Ser/Thr kinases known for their role in the control of cell cycle progression. In 1992, this family was joined by CDK5, which is an atypical member in that it uses its own activators and is multifunctional, playing important regulatory roles in multiple cellular functions. CDK5, unlike other Cdks, is not regulated by cyclins, and its activity is primarily detected in postmitotic neurons in developing and adult nervous systems. CDK5 is activated by association with a neuron-specific activator, p35 or its isoform p39. CDK5 is probably involved in the control of the cell cycle. It interacts with D1 and D3-type G1 cyclins. CDK5 can phosphorylate histone H1, tau, MAP2 and NF-H and NF-M. It also interacts with p35 which activates the kinase. CDK5 plays important roles in various neuronal activities, including neuronal migration, synaptic activity, and neuronal cell death.

References
  • Smith,D.S. et al., 2001, Cell Growth Differ. 12 (6):277-83.
  • Mapelli,M. et al., 2003, Neurosignals.  12 (4-5):164-72.
  • Cheng,K. et al., 2003, Neurosignals. 12 (4-5):180-90.
  • Fischer,A. et al., 2003, Curr Drug Targets CNS Neurol Disord 2 (6): 375 - 81.
  • Lalioti,V. et al., 2010, Cell Cycle  9 (2): 284-311.
  • Size / Price
    Catalog: MG50574-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"