Quick Order

Mouse ARMETL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDNFcDNA Clone Product Information
cDNA Size:564
cDNA Description:ORF Clone of Mus musculus arginine-rich, mutated in early stage tumors-like 1 DNA.
Gene Synonym:CDNF, MGC129430, 9330140G23, Armetl1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Neurotrophin & Receptor Related Products

Cerebral Dopamine Neurotrophic Factor (CDNF), also known as ARMETL1 (ARMET-like protein 1), is a secreted protein with eight conserved cysteine residues, predicting a unique protein fold and defining a new, evolutionarily conserved protein family. CDNF is a novel neurotrophic factor with strong trophic activity on dopaminergic neurons comparable to that of glial cell line-derived neurotrophic factor (GDNF). CDNF/ARMETL1 is a evolutionary conserved protein which can protect and restore the function of dopaminergic neurons in the rat model of Parkinson's disease, suggesting that CDNF might be beneficial for the treatment of Parkinson's disease. CDNF is widely expressed in neurons in several brain regions including cerebral cortex, hippocampus, substantia nigra, striatum and cerebellum. Human CDNF is glycosylated and secreted from transiently transfected cells. CDNF promotes the survival, growth, and function of dopamine-specific neurons and is expressed in brain regions that undergo cocaine-induced neuroplasticity.

  • Choi JM, et al. (2011) Analysis of mutations and the association between polymorphisms in the cerebral dopamine neurotrophic factor (CDNF) gene and Parkinson disease. Neurosci Lett. 493(3): 97-101.
  • Sun ZP, et al. (2011) Intracellular trafficking and secretion of cerebral dopamine neurotrophic factor in neurosecretory cells. J Neurochem. 117(1): 121-32.
  • Lohoff FW, et al. (2009) Association analysis between polymorphisms in the conserved dopamine neurotrophic factor (CDNF) gene and cocaine dependence. Neurosci Lett. 453(3): 199-203.
  • Lindholm P, et al. (2007) Novel neurotrophic factor CDNF protects and rescues midbrain dopamine neurons in vivo. Nature. 448(7149): 73-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks