After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CDK1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001786.4
RefSeq ORF Size:894bp
cDNA Description:Full length Clone DNA of Homo sapiens cell division cycle 2, G1 to S and G2 to M transcript variant 1 with Flag tag.
Gene Synonym:CDK1, CDC28A, MGC111195, DKFZp686L20222, CDC2
Species:Human
Vector:pCMV2-FLAG
Plasmid:pCMV2-CDK1-flag
Restriction Site:HindIII + XhoI (5.4kb + 0.94kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, Flag tag on other vectors
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, C-GFPSpark tagHG10739-ACG$325
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10739-ACR$325
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, N-GFPSpark tagHG10739-ANG$325
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10739-ANR$325
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, C-Flag tagHG10739-CF$295
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, C-His tagHG10739-CH$295
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, C-Myc tagHG10739-CM$295
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, C-HA tagHG10739-CY$295
Human CDC2 Kinase / CDK1 transcript variant 1 Gene cDNA clone plasmidHG10739-M$195
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, Flag tagHG10739-M-F$395
Human CDC2 Kinase / CDK1 transcript variant 1 natural ORF mammalian expression plasmidHG10739-M-N$395
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, N-Flag tagHG10739-NF$295
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, N-His tagHG10739-NH$295
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, N-Myc tagHG10739-NM$295
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, N-HA tagHG10739-NY$295
Human CDC2 Kinase / CDK1 transcript variant 1 natural ORF mammalian expression plasmidHG10739-UT$295
 Learn more about expression Vectors
Product nameProduct name
Background

CDC2, also known as CDK1, contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family, CDC2/CDKX subfamily. CDC2 is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with CDC2 and function as regulatory subunits. The kinase activity of CDK1 is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of CDC2 also play important regulatory roles in cell cycle control. It is required in higher cells for entry into S-phase and mitosis. CDC2 also is a cyclin-dependent kinase which displays CTD kinase activity and is required for RNA splicing. It has CTD kinase activity by hyperphosphorylating the C-terminal heptapeptide repeat domain (CTD) of the largest RNA polymerase II subunit RPB1, thereby acting as a key regulator of transcription elongation. CDK1 is required for RNA splicing, possibly by phosphorylating SRSF1/SF2. It is involved in regulation of MAP kinase activity, possibly leading to affect the response to estrogn inhibitors.

References
  • Lee MG, et al. (1987) Complementation used to clone a human homologue of the fission yeast cell cycle control gene cdc2. Nature. 327(6117):31-5.
  • Enserink JM, et al. (2010) An overview of Cdk1-controlled targets and processes. Cell Division. 5(11): 1-41.
  • Ninomiya-Tsuji J, et al. (1991) Cloning of a human cDNA encoding a CDC2-related kinase by complementation of a budding yeast cdc28 mutation. Proc Natl Acad Sci. 88(20):9006-10.
  • Zhan Q, et al. (1999) Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene. 18(18):2892-900.
  • Jin S, et al. (2000) The GADD45 inhibition of Cdc2 kinase correlates with GADD45-mediated growth suppression. J Biol Chem. 275(22):16602-8.
  •  

    Size / Price
    Catalog: HG10739-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"