Quick Order

Text Size:AAA

Human PDRG1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PDRG1cDNA Clone Product Information
Gene_bank_ref_id:BC009334
cDNA Size:402
cDNA Description:ORF Clone of Homo sapiens p53 and DNA-damage regulated 1 DNA.
Gene Synonym:RP1-310O13.8, C20orf126, PDRG, PDRG1
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
 
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

PDRG1, also known as C20orf126, belongs to the prefoldin subunit beta family. It is predominantly expressed in normal testis and exhibits reduced but detectable expression in other organs. PDRG1 may play a role in chaperone-mediated protein folding. PDRG1 is overexpressed in tumors relative to normal tissues. Its expression is upregulated in multiple malignancies including cancers of the colon, rectum, ovary, lung, stomach, breast and uterus when compared to their respective matched normal tissues. Thus PDRG1 is a high-value novel tumor marker that could play a role in cancer development and/or progression.

References
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Havugimana PC. et al., 2012, Cell. 150 (5): 1068-81.
  • Jiang L. et al., 2011, Cancer Biol Ther. 11 (6): 567-73.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"