Quick Order

Text Size:AAA

Mouse WARS ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse WARS cDNA Clone Product Information
Gene_bank_ref_id:NM_001164314.1
RefSeq ORF Size:1428bp
cDNA Description:Full length Clone DNA of Mus musculus tryptophanyl-tRNA synthetase with N terminal Myc tag.
Gene Synonym:WRS, TrpRS
Species:Mouse
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

WARS, also known as TrpRS, is an aminoacyl-tRNA synthetase which belongs to the class-I aminoacyl-tRNA synthetase family. There are two forms of tryptophanyl-tRNA synthetase: a cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. They catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. WARS catalyzes the aminoacylation of tRNA(trp) with tryptophan and is induced by interferon.

References
  • Buwitt U. et al., 1992, EMBO J. 11 (2): 489-96.
  • Fleckner J. et al., 1992, Proc Natl Acad Sci. 88 (24): 11520-4.
  • Ewalt KL. et al., 2002, Biochemistry. 41 (45): 13344-9.
  • Size / Price
    Catalog: MG51542-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"