Quick Order

Text Size:AAA

Human DYRK3 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DYRK3cDNA Clone Product Information
cDNA Size:1767
cDNA Description:ORF Clone of Homo sapiens dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 DNA.
Gene Synonym:RED, REDK, DYRK5, hYAK3-2, DYRK3
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human DYRK3 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged on other vectors
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10726-ACG$345
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10726-ACR$345
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10726-ANG$345
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10726-ANR$345
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10726-CF$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10726-CH$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10726-CM$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10726-CY$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone)HG10726-M$195
Human DYRK3 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10726-M-F$395
Human DYRK3 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10726-M-N$395
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10726-NF$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10726-NH$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10726-NM$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10726-NY$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10726-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Dual specificity tyrosine-phosphorylation-regulated kinase 3, also known as Regulatory erythroid kinase, REDK and DYRK3, is a nucleus protein which belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family and MNB/DYRK subfamily. DYRKs are an emerging family of dual-specificity kinases that play key roles in cell proliferation, survival, and development. DYRK3 contains one protein kinase domain. Isoform 1 and isoform 2 of DYRK3 are highly expressed in testis and in hematopoietic tissue such as fetal liver, and bone marrow. Isoform 2 of DYRK3 is the predominant form in testis. Isoform 1 of DYRK3 is the predominant form in fetal liver and bone marrow. Isoform 1 and isoform 2 are present at low levels in heart, pancreas, lymph node, and thymus. DYRK3 is a negative regulator of EPO-dependent erythropoiesis. It may place an upper limit on red cell production during stress erythropoiesis. DYRK3 inhibits cell death due to cytokine withdrawal in hematopoietic progenitor cells. It may also act by regulating CREB/CRE signaling. DYRK3 proved to effectively inhibit NFAT (nuclear factor of activated T cells) transcriptional response pathways and to co-immunoprecipitate with NFATc3. DYRK3 attenuates (and possibly apportions) red cell production selectively during anemia.

  • Becker W., et al., 1998, J. Biol. Chem. 273: 25893-25902.
  • Himpel,S. et al., 2000,J Biol Chem  275 (4):2431-8.
  • Li,K. et al., 2002, J Biol Chem. 277 (49):47052-60.
  • Bogacheva,O. et al., 2008, J Biol Chem. 283 (52):36665-75.
  • Guo,X. et al., 2010, J Biol Chem.285 (17):13223-32.
  • Size / Price
    List Price: $395.00  (Save $80.00)
    Price:$315.00      [How to order]
    Availability5 business days
      Recently Viewed Items