Quick Order

Mouse CLMP / ASAM ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CLMP cDNA Clone Product Information
Gene_bank_ref_id:NM_133733.4
RefSeq ORF Size:1122bp
cDNA Description:Full length Clone DNA of Mus musculus RIKEN c DNA.9030425E11 gene with C terminal His tag.
Gene Synonym:ACAM, ASP5, CLMP, AW557819, 9030425E11Rik
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Adipocyte-specific adhesion molecule (ASAM), also known as ACAM and CLMP, is a type I transmembrane protein and a member of the CTX (cortical thymocyte marker in Xenopus) family within the immunoglobulin superfamily. ASAM protein is highly expressed in the small intestine and placenta, and is found at intermediate levels in the heart, skeletal muscle, colon, spleen, kidney, and lung, and appears in low levels in the liver and peripheral blood leukocytes as well. ASAM is a transmembrane component of tight junctions in epithelial cells that can mediate cell aggregation and regulate transepithelial resistance across polarized epithelial cells. In addition, its expression is strongly correlated with white adipose tissue (WAT) mass of human and rodents with obesity.

References
  • Eguchi J, et al. (2005) Identification of adipocyte adhesion molecule (ACAM), a novel CTX gene family, implicated in adipocyte maturation and development of obesity. Biochem J. 387(Pt 2): 343-53.
  • Sze KL, et al. (2008) Expression of CLMP, a novel tight junction protein, is mediated via the interaction of GATA with the Kruppel family proteins, KLF4 and Sp1, in mouse TM4 Sertoli cells. J Cell Physiol. 214(2): 334-44.
  • Sze KL, et al. (2008) Post-transcriptional regulation of CLMP mRNA is controlled by tristetraprolin in response to TNFalpha via c-Jun N-terminal kinase signalling. Biochem J. 410(3): 575-83.
  • Size / Price
    Catalog: MG50553-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"