Quick Order

Human APOA1 / ApoAI ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human APOA1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human APOA1 Gene Expression validated Image
[Click to enlarge image]
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human APOA1 / ApoAI natural ORF mammalian expression plasmid, Flag tag
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Apolipoprotein A1 (APOA1) is a member of the apolipoprotein family whose members are proteins bind with lipids and form lipoproteins to translate these oil-soluble lipids such as fat and cholesterol through lymphatic and circulatory system. APOA1 is the main component of high density lipoprotein (HDL) in plasma and is involved in the esterification of cholesterol as a cofactor of lecithin-cholesterol acyltransferase (LCAT) which is responsible for the formation of most plasma cholesteryl esters, and thus play a major role in cholesterol efflux from peripheral cells. As a major component of the HDL complex, APOA1 helps to clear cholesterol from arteries. APOA1 is also characterized as a prostacyclin stabilizing factor, and thus may have an anticlotting effect. Defects in encoding gene may result in HDL deficiencies, including Tangier disease, and with systemic non-neuropathic amyloidosis. Men carrying a mutation may develop premature coronary artery disease.

  • Toptas B, et al. (2011) Comparison of lipid profiles with APOA1 MspI polymorphism in obese children with hyperlipidemia. In Vivo. 25(3): 425-30.
  • Haase CL, et al. (2011) Mutation in APOA1 predicts increased risk of ischaemic heart disease and total mortality without low HDL cholesterol levels. J Intern Med. 270(2): 136-46.
  • Wu Z, et al. (2011) The low resolution structure of ApoA1 in spherical high density lipoprotein revealed small angle neutron scattering. J Biol Chem. 286(14): 12495-508.