After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse DDR2 Kinase / CD167b Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DDR2cDNA Clone Product Information
Gene_bank_ref_id:NM_022563.2
cDNA Size:2565
cDNA Description:ORF Clone of Mus musculus discoidin domain receptor family, member 2 DNA.
Gene Synonym:Ntrkr3, tyro10, AW495251, Ddr2
Species:Mouse
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Receptor Tyrosine Kinase (RTK) Related Products
Product nameProduct name
Rat PDGFRa / CD140a Protein (Fc Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (Fc Tag)Cynomolgus EphB1 / EPHT2 Protein (His Tag)Cynomolgus FGFR1 / CD331 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (His Tag, ECD)Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Human KIT / c-KIT / CD117 Protein (Fc Tag)Human VEGFR1 / FLT-1 Protein (Fc Tag)Human FGFR2 / CD332 Protein (ECD, His Tag)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, Fc Tag)Human HER2 / ErbB2 ProteinCanine TrkB / NTRK2 Protein (Fc Tag)Rhesus HER3 / ErbB3 ProteinCynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human HER3 / ErbB3 ProteinHuman FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, His Tag)Cynomolgus / Rhesus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Mouse EphB6 Protein (His Tag)Cynomolgus / Rhesus c-MET / HGFR Protein (Fc Tag)Cynomolgus / Rhesus c-MET / HGFR Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Human TrkB / NTRK2 Protein (His & Fc Tag)Human TrkB / NTRK2 Protein (His Tag)Human TrkC / NTRK3 Protein (His & Fc Tag)Human TrkC / NTRK3 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & GST Tag)Human CSF1R / MCSF Receptor / CD115 Protein (aa 543-922, His & GST Tag)Human CSF1R / MCSF Receptor / CD115 ProteinHuman IGF1R / CD221 Protein (His Tag)Human EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 Protein (His Tag)Human EphB6 / EphB6 ProteinHuman HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human DDR2 Kinase / CD167b Protein (Fc Tag)Human DDR2 Kinase / CD167b Protein (His Tag)Human DDR2 Kinase / CD167b Protein (aa 422-855, His & GST Tag)Human EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB4 / HTK ProteinHuman Axl Kinase Protein (His Tag)Human MERTK / Mer Protein (His & Fc Tag)Human MERTK / Mer Protein GST TagHuman MERTK / Mer ProteinHuman MERTK / Mer(aa 578-872) ProteinHuman / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human Tie1 Protein (His Tag)Human PDGFRB / CD140b Protein (His & Fc Tag)Human CD140b / PDGFRB Protein (His Tag)Human PDGFRB / PDGFR-1 / CD140b ProteinHuman FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (Fc Tag)Human PDGFRa / CD140a Protein (Fc Tag)Human PDGFRa / CD140a Protein (His Tag)Human PDGFRa / CD140a Protein (His & GST Tag)Human PDGFRa / CD140a ProteinHuman FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR1 / CD331 Protein (His Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human c-MET / HGFR Protein (His & Fc Tag)Human c-MET / HGFR Protein (His Tag)Human c-MET / HGFR Protein (aa 956-1390, His & GST Tag)Human Tie2 / CD202b Protein (His & Fc Tag)Human Tie2 / CD202b / TEK Protein (His Tag)Human Tie2 / CD202b / TEK Protein (His & GST Tag)Human DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Human DDR1 Kinase / MCK10 / CD167 Protein (aa 444-913, His & GST Tag)Human EphB2 Protein (His & Fc Tag)Human EphB2 Protein (His Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Human EphB2 / Hek5 ProteinHuman VEGFR3 / FLT4 Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human FGFR2 Protein (His & Fc Tag)Human FGFR2 / CD332 Protein (His Tag)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Cynomolgus / Rhesus c-MET / HGFR ProteinCynomolgus HER2 / ErbB2 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human TrkA / NTRK1 Protein (His & Fc Tag)Human TrkA / NTRK1 Protein (aa 285-413, His Tag)Human TrkA / NTRK1 Protein (aa 194-413, His Tag)Human TrkA / NTRK1 Protein (His Tag)Human Insulin Receptor / INSR / CD220 Protein (long isoform, His Tag)Human Insulin Receptor / INSR / CD220 Protein (His & GST Tag)Human Insulin Receptor / INSR / CD220 Protein (short isoform, His Tag)Human EphA4 Protein (His & Fc Tag)Human EphA4 Protein (His Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Human CD136 / MST1R Protein (His Tag)Human EphA7 / EHK3 Protein (His Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Mouse Tie2 / CD202b / TEK Protein (ECD, Fc Tag)Human MUSK Kinase Protein (aa 433-783, His & GST Tag)Human EphB1 / EPHT2 Protein (His Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human KIT / c-KIT / CD117 Protein (aa 50-190, His Tag)Human c-KIT / CD117 Protein (His Tag)Human KIT / c-KIT / CD117 Protein (aa 540-972, His & GST Tag)Human RET Kinase Protein (His Tag)Human RET Kinase Protein (aa 658-1114, His & GST Tag)Cynomolgus FGFR3 Protein (Fc Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Human EphA2 Protein (His Tag)Human EphA2 Protein (aa 585-976, His & GST Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His Tag)Mouse Axl Kinase Protein (His & Fc Tag)Mouse Axl Kinase Protein (His Tag)Mouse TrkB / NTRK2 Protein (His Tag)Mouse FGFRL1 / FGFR5 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Mouse TrkC / NTRK3 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Mouse MERTK / Mer Protein (Fc Tag)Mouse MERTK / Mer Protein (His & GST Tag)Mouse c-kit / CD117 Protein (Fc Tag)Mouse c-kit / CD117 Protein (His Tag)Mouse DDR2 Kinase / CD167b Protein (His Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse VEGFR3 / FLT-4 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Mouse VEGFR3 / FLT-4 Protein (His Tag)Mouse EphA2 Protein (His Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse c-MET / HGFR Protein (Fc Tag)Mouse c-MET / HGFR Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Mouse FGFR2 / CD332 Protein (His Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Mouse EphA1 / EPH receptor A1 Protein (His Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (Fc Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (His & GST Tag)Canine HER2 / ErbB2 Protein (His Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Mouse HER4 / ErbB4 Protein (His Tag)Mouse Tie2 / TEK Protein (His Tag)Mouse Tie2 / TEK Protein (aa 770-1122, His & GST Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Mouse TrkA / NTRK1 Protein (Fc Tag)Mouse TrkA / NTRK1 Protein (His Tag)Canine c-MET / HGFR Protein (His Tag)Canine TrkB / NTRK2 Protein (His Tag)Canine TrkA / NTRK1 Protein (Fc Tag)Canine TrkA / NTRK1 Protein (His Tag)Rat c-MET / HGFR Protein (Fc Tag)Rat Tie2 / TEK Protein (Fc Tag)Rat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rat HER2 / ErbB2 ProteinRat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Rat EGFR / HER1 / ErbB1 Protein (His Tag)Rat VEGFR1 / FLT-1 Protein (His Tag)Rat EphA7 / EHK3 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Rat EphA4 Protein (Fc Tag) Rat EphA4 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Rat TrkB / NTRK2 Protein (Fc Tag)Rat TrkB / NTRK2 Protein (His Tag)Rat KIT / c-KIT Protein (Fc Tag)Rat KIT / c-KIT Protein (His Tag)Rat DDR2 Kinase / CD167b Protein (Fc Tag)Rat DDR2 Kinase / CD167b Protein (His Tag)Rat PDGFRB / PDGFR-1 Protein (Fc Tag)Rat PDGFRB / PDGFR-1 Protein (His Tag)Rat TrkA / NTRK1 Protein (Fc Tag)Rat TrkA / NTRK1 Protein (His Tag)Rat DDR1 Kinase / MCK10 / CD167 Protein (Fc Tag) Rat DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (His Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Cynomolgus EphA4 Protein (Fc Tag)Cynomolgus EphA4 Protein (His Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Cynomolgus FGFR1 / CD331 Protein (Fc Tag)Rhesus EGFR / HER1 / ErbB1 Protein (His Tag, ECD)Cynomolgus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (His Tag)Cynomolgus PDGFRB / PDGFR-1 Protein (His Tag)Cynomolgus DDR2 Kinase / CD167b Protein (Fc Tag)Cynomolgus DDR2 Kinase / CD167b Protein (His Tag)Cynomolgus Tie2 / TEK Protein (Fc Tag)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse EphB2 / Hek5 Protein (His Tag)Cynomolgus / Rhesus PDGFRB / CD140b Protein (Fc Tag)Rat HER4 / ErbB4 Protein (His Tag)Rat PDGFRa / CD140a Protein (His Tag)Cynomolgus EphB1 / EPHT2 Protein (Fc Tag)
Background

Discoidin domain receptor 2 (DDR2) or CD167b (cluster of differentiation 167b) is a kind of protein tyrosine kinases associated with cell proliferation and tumor metastasis, and collagen, identified as a ligand for DDR2, up-regulates matrix metallloproteinase 1 (MMP-1) and MMP-2 expression in cellular matrix. DDR2/CD167b was found to recognise the triple-helical region of collagen X as well as the NC1 domain. Binding to the collagenous region was dependent on the triple-helical conformation. DDR2/CD167b autophosphorylation was induced by the collagen X triple-helical region but not the NC1 domain, indicating that the triple-helical region of collagen X contains a specific DDR2 binding site that is capable of receptor activation. DDR2/CD167b is induced during stellate cell activation and implicate the phosphorylated receptor as a mediator of MMP-2 release and growth stimulation in response to type I collagen. Moreover, type I collagen-dependent upregulation of DDR2/CD167b expression establishes a positive feedback loop in activated stellate cells, leading to further proliferation and enhanced invasive activity.

References
et al.
  • Olaso E, et al. (2001) DDR2 receptor promotes MMP-2-mediated proliferation and invasion by hepatic stellate cells. J Clin Invest. 108(9): 1369-78.
  • Zhang W, et al. (2006) Expression of discoidin domain receptor 2 (DDR2) extracellular domain in pichia pastoris and functional analysis in synovial fibroblasts and NIT3T3 cells. Mol Cell Biochem. 290(1-2): 43-53.
  • Leitinger B, et al. (2006) The discoidin domain receptor DDR2 is a receptor for type X collagen. Matrix Biol. 25(6): 355-64.
  • Leitinger B, et al. (2004) The D2 period of collagen II contains a specific binding site for the human discoidin domain receptor, DDR2. J Mol Biol. 344(4): 993-1003.
  • Size / Price
    Catalog:MG50541-CH
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"