Quick Order

Text Size:AAA

Human BRK Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTK6cDNA Clone Product Information
cDNA Size:1356
cDNA Description:ORF Clone of Homo sapiens PTK6 protein tyrosine kinase 6 DNA.
Gene Synonym:BRK, FLJ42088, PTK6
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human BRK Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged on other vectors
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10682-ACG$325
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10682-ACR$325
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10682-ANG$325
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10682-ANR$325
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10682-CF$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10682-CH$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10682-CM$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10682-CY$295
Human BRK Gene cDNA Clone (full-length ORF Clone)HG10682-M$95
Human BRK Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10682-M-F$295
Human BRK Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10682-M-N$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10682-NF$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10682-NH$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10682-NM$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10682-NY$295
Human BRK Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10682-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Tyrosine kinase (PTKs) is a protein that carry out tyrosine phosphorylation, which play a fundamental role in cell proliferation, survival, adhesion, and motility and have also been demenstrated to mediate malignant cell transformation. Overexpression of this protein in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Two classes of PTKs are present in cells: the transmembrane receptor PTKs and the non-receptor PTKs. Tyrosine kinase(PTKs)-6/ BRK is a cytoplasmic non-receptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Tyrosine kinase(PTKs)-6/ BRK has been shown to undergo autophosphorylation. It has been found that the constitutive expression of the tyrosine kinase(PTKs)-6/ BRK is in a large proportion of cutaneous T-cell lymphomas and other transformed T- and B-cell populations. State BRK expression was also induced in normal T-cells. In clinical, the cytoplasmic tyrosine kinase PTK6 (BRK) shows elevated expression in approximately two-thirds of primary breast tumours, and is implicated in EGF receptor-dependent signalling and epithelial tumorigenesis.

  • Aubele M, et al. (2008) Prognostic value of protein tyrosine kinase 6 (PTK6) for long-term survival of breast cancer patients.British Journal of Cancer. 99: 1089-95.
  • Kasprzycka M, et al. (2006) Expression and oncogenic role of Brk (PTK6/sik) protein tyrosine kinase in lymphocytes. American Journal of Pathology. 168: 1631-41.
  • Hubbard SR, et al. (2000) Protein tyrosine kinase structure and function. Annual review of biochemistry. 69: 373-98.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
      Recently Viewed Items