Quick Order

Text Size:AAA

Human CaM Kinase 2A ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CAMK2A cDNA Clone Product Information
Gene_bank_ref_id:NM_171825.1
RefSeq ORF Size:1437bp
cDNA Description:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase II alpha with Flag tag.
Gene Synonym:CAMKA, KIAA0968
Species:Human
Vector:pCMV2-FLAG
Plasmid:pCMV2-CAMK2A-flag
Restriction Site:HindIII + XhoI (5.4kb + 1.49kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1377T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Ca2+/calmodulin-dependent protein kinase2A (CAMK2A) belongs to the serine/threonine protein kinase family and, together with other 28 different isoforms, belongs to the Ca2+/ calmodulin-dependent protein kinase subfamily. CaM kinase Ⅱ is thought to be an important mediator of learning and memory and is also necessary for Ca2+ homeostasis and reuptake in cardiomyocytes chloride transport in epithelia, positive T-cell selection, and CD8 T-cell activation. CAMKIIA is one of the major forms of CAMKII. It has been found to play a critical role in sustaining activation of CAMKII at the postsynaptic density. Studies have found that knockout mice without CAMKIIA demonstrate a low frequency of LTP. Additionally, these mice do not form persistent, stable place cells in the hippocampus.

References
  • Lin CR, et al. (1987). Molecular cloning of a brain-specific calcium/calmodulin-dependent protein kinase. Proc Natl Acad Sci U S A. 84 (16): 5962-6.
  • Walikonis RS, et al. (2001) Densin-180 forms a ternary complex with the (alpha)-subunit of Ca2+/calmodulin-dependent protein kinase II and (alpha)-actinin. J Neurosci. 21 (2): 423-33.
  • Gardoni F, et al. (2003) CaMKII-dependent phosphorylation regulates SAP97/NR2A interaction. J Biol Chem. 278 (45): 44745-52.
  • Size / Price
    Catalog: HG10648-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"