Quick Order

Rat CSF2RB Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSF2RBcDNA Clone Product Information
cDNA Size:2691
cDNA Description:ORF Clone of Rattus norvegicus colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) DNA.
Gene Synonym:Csf2rb1, Csf2rb
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Colony-Stimulating Factor (CSF) & Receptor Related Products

Colony stimulating factor 2 receptor, beta, low-affinity (CSF2RB) also known as CD131 antigen (CD131), cytokine receptor common subunit beta, GM-CSF/IL-3/IL-5 receptor common beta-chain, interleukin 3 receptor/granulocyte-macrophage colony stimulating factor 3 receptor, beta (IL3RB), is the common beta chain of the high affinity receptor for IL-3, IL-5 and CSF. Defects in this protein have been reported to be associated with protein alveolar proteinosis (PAP). CD131 belongs to the type I cytokine receptor family. The cluster of differentiation (cluster of designation) (often abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules present on white blood cells initially but found in almost any kind of cell of the body, providing targets for immunophenotyping of cells. Defects in CD131/CSF2RB are the cause of pulmonary surfactant metabolism dysfunction type 5 (SMDP5). SMDP5 is a rare lung disorder due to impaired surfactant homeostasis. It is characterized by alveolar filling with floccular material that stains positive using the periodic acid-Schiff method and is derived from surfactant phospholipids and protein components. Excessive lipoproteins accumulation in the alveoli results in severe respiratory distress.

  • Selleri S, et al. (2008) GM-CSF/IL-3/IL-5 receptor common beta chain (CD131) expression as a biomarker of antigen-stimulated CD8+ T cells. J Transl Med. 6:17.
  • Woodcock, et al. (1994) Three residues in the common beta chain of the human GM-CSF, IL-3 and IL-5 receptors are essential for GM-CSF and IL-5 but not IL-3 high affinity binding and interact with Glu21 of GM-CSF. EMBO J. 13(21): 5176-85.
  • Dirksen U, et al. (1997) Human pulmonary alveolar proteinosis associated with a defect in GM-CSF/IL-3/IL-5 receptor common beta chain expression. J Clin Invest. 100(9): 2211-7.