After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CD6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD6cDNA Clone Product Information
cDNA Size:1998
cDNA Description:ORF Clone of Rattus norvegicus Cd6 molecule DNA.
Gene Synonym:OX52, MGC108551, Cd6
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

T-cell differentiation antigen CD6, also known as TP120 and CD6, is a single-pass type I membrane protein which contains three SRCR domains. CD6 / TP120 is a cell surface glycoprotein expressed primarily on T cells, it may function as a costimulatory molecule and may play a role in autoreactive immune responses. CD6 / TP120 is expressed by thymocytes, mature T-cells, a subset of B-cells known as B-1 cells, and by some cells in the brain. CD6 ligand termed CD166 (previously known as activated leukocyte cell adhesion molecule, ALCAM ) has been identified and shown to be expressed on activated T cells, B cells, thymic epithelium, keratinocytes, and in rheumatoid arthritis synovial tissue. CD6 / TP120 binds to activated leukocyte cell adhesion molecule ( CD166 ), and is considered as a costimulatory molecule involved in lymphocyte activation and thymocyte development. CD6 / TP120 partially associates with the TCR / CD3 complex and colocalizes with it at the center of the mature immunological synapse (IS) on T lymphocytes. During thymic development CD6-dependent signals may contribute both to thymocyte survival, and to the overall functional avidity of selection in both man and mouse.

  • Joo YS. et al., 2000, Arthritis Rheum. 43 (2): 329-35.
  • Singer NG. et al., 2002, Int Immunol. 14 (6): 585-97.
  • Gimferrer I. et al., 2005, J Immunol. 175 (3): 1406-14.
  • Alonso R. et al., 2010, J Autoimmun. 35 (4): 336-41.