After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CD99L2 transcript variant 1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CD99L2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001199349.1
RefSeq ORF Size:714bp
cDNA Description:Full length Clone DNA of Mus musculus CD99 antigen-like 2 transcript variant 1 with C terminal His tag.
Gene Synonym:Xap89, Mic2l1, AW548191, Cd99l2
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Mouse CD99 antigen-like protein 2, also known as MIC2-like protein 1, CD99L2 and MIC2L1, is a single-pass type I  membrane protein which belongs to the CD99 family. CD99L2 is expressed in brain, heart, lung, liver, spleen, kidney, stomach, small intestine, skeletal muscle, ovary, thymus, testis and uterus. Lower expression of CD99L2 is seen in thymus. It is also expressed in E18 uterus and placenta. CD99 and CD99L2 were required for leukocyte extravasation in the cremaster after stimulation with tumor necrosis factor-alpha, where the need for PECAM-1 is known to be bypassed. CD99 and CD99L2 act independently of PECAM-1 in leukocyte extravasation and cooperate in an independent way to help neutrophils overcome the endothelial basement membrane. CD99L2 may function as a homophilic adhesion molecule. It functions in leukocyte-endothelial cell interactions during leukocyte extravasation, and in particular, at the diapedesis step. CD99L2 does not seem to be involved in docking of leukocytes to the vessel wall or in lymphocyte diapedesis.

References
  • Suh, YH. et al., 2003, Gene. 307: 63-76.
  • Park,S.H. Gene 2005, 353 (2):177-88.
  • Schenkel, AR et al., 2007, Cell Commun Adhes. 14 (5):227-37.
  • Bixel, MG. et al., 2010, Blood. 116 (7):1172-84. 
  • Size / Price
    Catalog: MG50526-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"