After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human CD118 / LIFR Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LIFRcDNA Clone Product Information
cDNA Size:3294
cDNA Description:ORF Clone of Homo sapiens leukemia inhibitory factor receptor alpha DNA.
Gene Synonym:SWS, SJS2, STWS, CD118, LIF-R, FLJ98106, FLJ99923
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

IL-6 Family & Receptor Related Products
Product nameProduct name
Rat GM-CSF / CSF2 Protein (Fc Tag)Mouse Oncostatin M / OSM ProteinHuman Interleukin-31 receptor A / IL31RA Protein (Fc Tag, ECD)Canine IL-6R / CD126 Protein (ECD, His Tag)Human Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA Protein (Fc Tag)Human G-CSF / CSF3 Protein (isoform b)Rat IL-11RA1 / Il11RA1 Protein (His Tag)Mouse CNTF / Ciliary Neurotrophic Factor Protein (His Tag)Human NNT1 / CLCF1 / CLC Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human GM-CSF / CSF2 Protein (His Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 Protein (His Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman Leptin ProteinHuman IL11RA / IL11Rα Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His & Fc Tag)Human Leptin Receptor / LEPR / CD295 Protein (His Tag)Human IL6 / Interleukin-6 ProteinHuman IL6R / CD126 Protein (His Tag)Human Oncostatin M / OSM Protein (His Tag)Human LIFR / CD118 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Human IL6ST / gp130 / CD130 ProteinHuman CNTFR / CNTFR-alpha Protein (His Tag)Human OSMR / IL31RB Protein (His Tag)Mouse IL-31 / IL31 Protein (His Tag)Human CNTF Protein (His Tag)Human IL11 / Interleukin 11 / IL-11 ProteinRat IL-6R / CD126 Protein (ECD, His Tag)Human G-CSF / CSF3 Protein (isoform b)Human LIF Protein (Fc Tag)Human LIF Protein (His Tag)Mouse IL11RA / IL11Rα Protein (His Tag)Mouse Oncostatin M / OSM Protein (His Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Mouse IL6 / Interleukin-6 ProteinMouse IL6RA / CD126 Protein (His Tag)Mouse LIFR / CD118 Protein (His Tag)Mouse OSMR / IL-31RB Protein (His Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Human GM-CSF / CSF2 ProteinRat CNTF / Ciliary Neurotrophic Factor ProteinRat CNTFR / CNTFR-alpha Protein (His Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Human GM-CSF / CSF2 ProteinRat IL6 / Interleukin-6 ProteinCanine IL11RA / IL-11RA / IL11Rα Protein (His Tag)Rat LIFR Protein (His Tag)Human LIF ProteinHuman IL-31 / IL31 Protein (His Tag)Cynomolgus / Rhesus IL6 / Interleukin-6 ProteinCynomolgus IL6ST / gp130 Protein (Fc Tag)Cynomolgus IL6ST / gp130 Protein (His Tag)Mouse GM-CSF / CSF2 ProteinMouse IL-11 / interleukin 11 ProteinSus scrofa (pig) IL6 / IL-6 ProteinRat IL-6R / CD126 Protein (Fc Tag, ECD)Human Interleukin-31 receptor A / IL31RA Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Canine IL11RA / IL-11RA / IL11Rα Protein

LIFR (leukemia inhibitory factor receptor) belongs to the family of cytokine receptors. LIFR forms a high-affinity receptor complex with gp130, which mediates the activity of LIF (leukemia inhibitory factor) and thus affects the differentiation, proliferation, and survival of a wide variety of cells in the adult and the embryo. Besides LIF, LIFR can also bind to and activate CNTF (ciliary neurotrophic factor) and CLC (cardiotrophin like cytokine). Evidence showed that in the retina, LIFR activating LIF, CT-1 and cardiotrophin like cytokine (CLC) are strongly upregulated in response to preconditioning with bright cyclic light leading to robust activation of signal transducer and activator of transcription-3 (STAT3) in a time-dependent manner. Further, blocking LIFR activation during preconditioning using a LIFR antagonist (LIF05) attenuated the induced STAT3 activation and also resulted in reduced preconditioning-induced protection of the retinal photoreceptors. These data demonstrate that LIFR and its ligands play an essential role in endogenous neuroprotective mechanisms triggered by preconditioning-induced stress. LIFR was newly found to be a suppressor of hepatocellular carcinoma (HCC), one of the world's top five causes of cancer-related deaths.

  • Gearing, D.P. et al.,1991, EMBO J. 10 (10): 2839-2848.
  • Gearing, D.P. et al.,1992, New Biol. 4 (1): 61-65.
  • Mosley, B. et al.,1996, J. Biol. Chem. 271 (51): 32635-32643.
  • Timmermann, A. et al.,2002, Eur. J. Biochem. 269 (11): 2716-2726.
  • Lass, A. et al.,2002, Fertil. Steril. 76 (6): 1091-1096.
  • Size / Price
    List Price: $645.00  (Save $250.00)
    Price:$395.00      [How to order]
    Availability5 business days
      Recently Viewed Items