Quick Order

Mouse IFNA2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse IFNA2 cDNA Clone Product Information
Gene_bank_ref_id:NM_010503.2
RefSeq ORF Size:573bp
cDNA Description:Full length Clone DNA of Mus musculus interferon alpha 2 with C terminal His tag.
Gene Synonym:Ifa2, Ifna2
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Mouse IFNA2 / Interferon alpha 2 ProteinRhesus IFNA2 / Interferon alpha 2 ProteinHuman IL29 / IFNL1 ProteinCynomolgus IFNAR2 / IFNABR Protein (ECD, His Tag)Human IFNA4 Protein (His Tag)Human Interferon alpha 2 / IFNA2 ProteinMouse IL-28B / IFN-lambda-3 Protein (His Tag)Rhesus IFNG / Interferon Gamma ProteinHuman IL-28B / IFN-lambda-3 Protein (His Tag)Human IFN-alpha / IFNA1 / IFN Protein (His Tag)Human Interferon alpha-B / IFNA8 Protein (His Tag)Human IFNα4 / IFNa4 / Interferon alpha-4 Protein (Fc Tag)Human IFNA5 / IFNaG / Interferon alpha-G Protein (Fc Tag)Human Interferon beta / IFN-beta / IFNB Protein (Fc Tag)Human IFNGR1 / CD119 Protein (His & Fc Tag)Human Interferon omega-1 / IFNω / IFNW1 Protein (Fc Tag)Human IFNGR1 / CD119 Protein (His Tag)Mouse IFNAR1 / IFNAR Protein (His Tag)Human IFNAR2 / IFNABR Protein (Fc Tag)Human IFNAR2 / IFNABR Protein (His Tag)Human IFN-gamma / IFNG / γ-IFN ProteinHuman IFNL3 / IL28B / Interleukin-28B Protein (His Tag)Human IL-29 / Interleukin-29 Protein (His Tag)Mouse IFNGR2 Protein (His Tag)Mouse IFNG / Interferon Gamma Protein (Fc Tag)Mouse IFNG / Interferon Gamma Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (Fc Tag)Mouse IFNA4 / Interferon alpha-4 Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (His Tag)Mouse IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Human Interferon alpha 7 / IFNA7 Protein (Fc Tag)Human Interferon alpha 10 / IFNA10 Protein (Fc Tag)Mouse IFNA5 / IFNaG Protein (His Tag)Human IFNα4 / IFNa4 / Interferon alpha-4 Protein (His Tag)Human IFNAR1 / IFNAR Protein (Fc Tag)Human IFNAR1 / IFNAR Protein (His Tag)Mouse IFNA2 / Interferon alpha 2 Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (Fc Tag)Rat IFNG / Interferon Gamma Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (His Tag)Rat IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Human IFN omega 1 / IFNW1 Protein (His Tag)Rat IFNA5 / IFNaG Protein (His Tag)Human Interferon beta / IFN-beta / IFNB ProteinCynomolgus IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Rhesus IFNA2 / Interferon alpha 2 Protein (Fc Tag)Cynomolgus IFNA13 / Interferon alpha-13 Protein (Fc Tag)Rat IFNGR / IFNGR1 Protein (Fc Tag)Mouse IFNA5 / IFNaG Protein (Fc Tag)Mouse IFNG / Interferon Gamma ProteinCynomolgus IFNA13 / Interferon alpha-13 Protein (His Tag)Cynomolgus IFNGR / IFNGR1 Protein (Fc Tag)Rhesus IFNAR1 / IFNAR Protein (His Tag)Mouse IFNB1 / IFN-beta / Interferon beta ProteinCynomolgus Interferon alpha-B / IFNA8 Protein (Fc Tag)Cynomolgus Interferon alpha-B / IFNA8 Protein (His Tag)Human Interferon alpha-B / IFNA8 ProteinFerret IFNG / Interferon Gamma Protein (His Tag)Cynomolgus IFNGR / IFNGR1 Protein (His Tag)Rhesus IFNA14 / Interferon alpha-14 Protein (His Tag)Rhesus IFNA2 / Interferon alpha 2 Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (His Tag)Rhesus IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Rhesus IFNAR1 / IFNAR Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (His Tag)Mouse IFNA4 / IFNα4 / Interferon alpha-4 Protein (His Tag)Rhesus IFNAR1 / IFNAR ProteinRhesus IFN gamma Protein (His Tag)
References
  • Wang, et al. (2004) Fever of recombinant human interferon-alpha is mediated by opioid domain interaction with opioid receptor inducing prostaglandin E2. J Neuroimmunol. 156(1-2): 107-12.
  • Groopman JE, et al. (1984) Recombinant alpha-2 interferon therapy for Kaposi's sarcoma associated with the acquired immunodeficiency syndrome. Ann Intern Med. 100(5): 671-6.
  • Krueger JM, et al. (1987) Interferon alpha-2 enhances slow-wave sleep in rabbits. Int J Immunopharmacol. 9(1): 23-30.
  • Size / Price
    Catalog: MG50525-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"