After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human AIMP1 / SCYE1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AIMP1 cDNA Clone Product Information
RefSeq ORF Size:939bp
cDNA Description:Full length Clone DNA of Homo sapiens small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) with Flag tag.
Gene Synonym:p43, AIMP1, EMAP2, EMAP-2, EMAPII, EMAP-II
Restriction Site:HindIII + XhoI (5.4kb + 0.99kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Aminoacyl tRNA synthase complex-interacting multifunctional protein 1, also known as Multisynthase complex auxiliary component p43, Endothelial monocyte-activating polypeptide II, AIMP1, EMAP2 and SCYE1, is a nucleus protein which contains one tRNA-binding domain. AIMP1 (also known as p43) is a factor associated with a macromolecular aminoacyl-tRNA synthetase (ARS) complex but also plays diverse regulatory roles in various physiological processes. AIMP1 negatively regulates TGF-beta signaling via stabilization of Smurf2. It suggests the novel activity of AIMP1 as a component of negative feedback loop of TGF-beta signaling. Recently, it been demonstrated that AIMP1 is also secreted and acts as a novel pleiotropic cytokine. AIMP1 protein induces the maturation and activation of DCs, which skew the immune response toward a Th1 response. AIMP1 is known as a cytokine working in the control of angiogenesis, inflammation, and wound healing. AIMP1 is secreted from the pancreas upon glucose starvation, and it also plays a glucagon-like role in glucose homeostasis. Although AIMP1 was identified as a component of the macromolecular aminoacyl tRNA synthetase complex involved in the cellular translation process, it was also found to be secreted as a cytokine having complex physiological functions. Among these, AIMP1's angiostatic and immune stimulating activities suggest its potential use as a novel antitumor therapeutic protein. AIMP1 may exert its antitumor activity by inducing tumor-suppressing cytokines. Thus, AIMP1 may be useful as a novel anti-tumor agent.

  • Lee YS, et al. (2006) Antitumor activity of the novel human cytokine AIMP1 in an in vivo tumor model. Mol Cells. 21(2): 213-7.
  • Park SG, et al. (2006) Hormonal activity of AIMP1/p43 for glucose homeostasis. Proc Natl Acad Sci U S A. 103(40): 14913-8.
  • Kim E, et al. (2008) AIMP1/p43 protein induces the maturation of bone marrow-derived dendritic cells with T helper type 1-polarizing ability. J Immunol. 180(5): 2894-902.
  • Lee YS, et al. (2008) AIMP1/p43 downregulates TGF-beta signaling via stabilization of smurf2. Biochem Biophys Res Commun. 371(3): 395-400.
  • Han JM, et al. (2010) Antitumor activity and pharmacokinetic properties of ARS-interacting multi-functional protein 1 (AIMP1/p43). Cancer Lett. 287(2): 157-64.
  • Size / Price
    Catalog: HG10623-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions