Quick Order

Text Size:AAA

Mouse MAPRE3 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse MAPRE3 cDNA Clone Product Information
Gene_bank_ref_id:NM_133350.1
RefSeq ORF Size:846bp
cDNA Description:Full length Clone DNA of Mus musculus microtubule-associated protein, RP/EB family, member 3 with N terminal Myc tag.
Gene Synonym:EB2, EB3, AI790651
Species:Mouse
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

MAPRE3, also known as EB3, is a member of the RP/EB family. MAPRE3 localizes to the cytoplasmic microtubule network and binds APCL. MAPRE3 regulates the dynamics of the microtubule cytoskeleton. It also promotes microtubule growth. MAPRE3 may be involved in spindle function by stabilizing microtubules and anchoring them at centrosomes. MAPRE3 may also play a role in cell migration.

References
  • Rual JF. et al., 2005, Nature. 437 (7062): 1173-8.
  • Yeh TY. et al., 2005, J Cell Sci. 118 (15): 3431-43.
  • Mimori-Kiyosue Y. et al., 2005, J Cell Biol. 168 (1): 141-53.
  • Size / Price
    Catalog: MG51507-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"