Quick Order

Rat SIRPA Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SIRPAcDNA Clone Product Information
cDNA Size:1530
cDNA Description:ORF Clone of Rattus norvegicus signal-regulatory protein alpha DNA.
Gene Synonym:Bit, Ptpns1, SHPS-1, Sirpa
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Tyrosine-protein phosphatase non-receptor type substrate 1, also known as SHP substrate 1, Inhibitory receptor SHPS-1, Brain Ig-like molecule with tyrosine-based activation motifs, Macrophage fusion receptor, CD172 antigen-like family member A, SIRPA and CD172a, is a single-pass type I membrane protein which contains two Ig-like C1-type (immunoglobulin-like) domains and one Ig-like V-type (immunoglobulin-like) domain. SIRPA is ubiquitously expressed. It is highly expressed in brain and detected at lower levels in heart, placenta, lung, testis, ovary, colon, liver, small intestine, prostate, spleen, kidney, skeletal muscle and pancreas. It is also detected on myeloid cells, but not T-cells. SIRPA is an immunoglobulin-like cell surface receptor for CD47. SIRPA acts as docking protein and induces translocation of PTPN6, PTPN11 and other binding partners from the cytosol to the plasma membrane. SIRPA supports adhesion of cerebellar neurons, neurite outgrowth and glial cell attachment. It may play a key role in intracellular signaling during synaptogenesis and in synaptic function. SIRPA is involved in the negative regulation of receptor tyrosine kinase-coupled cellular responses induced by cell adhesion, growth factors or insulin. It mediates negative regulation of phagocytosis, mast cell activation and dendritic cell activation.

  • Timms JF. et al., 1999, Curr Biol. 9: 927-30.
  • Stofega MR. et al., 2000, J Biol Chem. 275: 28222-9.
  • Liu T. et al., 2005, J Proteome Res. 4: 2070-80.
  • Wolf-Yadlin A. et al., 2007, Proc Natl Acad Sci. 104: 5860-5.