After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
XIAPcDNA Clone Product Information
cDNA Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10606-ACG$325
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10606-ACR$325
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10606-ANG$325
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10606-ANR$325
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10606-CF$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10606-CH$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10606-CM$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10606-CY$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone)HG10606-M$95
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10606-M-N$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10606-NF$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10606-NH$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10606-NM$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10606-NY$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10606-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

E3 ubiquitin-protein ligase XIAP / BIRC4, also known as inhibitor of apoptosis protein 3, X-linked inhibitor of apoptosis protein, and IAP-like protein, is a protein that belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat, which is necessary for their anti-apoptotic function. XIAP / BIRC4 functions through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 and inhibits apoptosis induced by menadione, a potent inducer of free radicals, and interleukin 1-beta converting enzyme. XIAP / BIRC4 also inhibits at least two members of the caspase family of cell-death proteases, caspase-3 and caspase-7. Mutations in this encoding gene are the cause of X-linked lymphoproliferative syndrome. Alternate splicing results in multiple transcript variants. Thought to be the most potent apoptosis suppressor, XIAP / BIRC4, directly binds and inhibits caspases -3, -7 and -9. Survivin, which also binds to several caspases, is up-regulated in a many tumour cell types. Defects in XIAP / BIRC4 are the cause of lymphoproliferative syndrome X-linked type 2 (XLP2). XLP is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Symptoms include severe or fatal mononucleosis, acquired hypogammaglobulinemia, pancytopenia and malignant lymphoma.

  • Holcik M, et al. (2000) Functional Characterization of the X-Linked Inhibitor of Apoptosis (XIAP) Internal Ribosome Entry Site Element: Role of La Autoantigen in XIAP Translation. Mol Cell Biol. 20 (13): 4648-57.
  • Winsauer G, et al. (2008) XIAP regulates bi-phasic NF-kappaB induction involving physical interaction and ubiquitination of MEKK2. Cell Signal. 20 (11): 2107-12.
  • Suzuki Y, et al. (2001) X-linked inhibitor of apoptosis protein (XIAP) inhibits caspase-3 and -7 in distinct modes. J Biol Chem. 276 (29): 27058-63.