After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human LOX-1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human OLR1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Oxidized low-density lipoprotein receptor 1 (Ox-LDL receptor 1 or OLR1), also known as lectin-type oxidized LDL receptor 1 (LOX1), is a receptor protein that belongs to the C-type lectin superfamily. LOX1 is a multi-ligand receptor originally identified as the endothelial oxidized LDL receptor. OLR1 / LOX1 was isolated from an aortic endothelial cell, and recently it has been discovered in macrophages and vascular smooth muscle cells in artery vessels. The expression of LOX1 is inducted by inflammatory stimuli and oxidative stimuli. This protein binds, internalizes and degrades oxidized low-density lipoprotein. LOX1 may play an important role in the progression of vulnerable carotid plaque and might regulate vulnerable plaque formation in cooperation with MMPs and TIMP-2. In clinical, LOX1 is thought to be involved in the development of atherosclerotic lesions. 

  • Hinagata J, et al. (2006) Oxidized LDL receptor LOX-1 is involved in neointimal hyperplasia after balloon arterial injury in a rat model. Cardiovasc Res. 69 (1): 263-71.
  • Melan MA, et al. (1994) The LOX1 Gene of Arabidopsis Is Temporally and Spatially Regulated in Germinating Seedlings. Plant Physiol. 105 (1): 385-93.
  • Saito A, et al. (2010) Relationship between lectin-like oxidized low-density lipoprotein receptor 1 expression and preoperative echogenic findings of vulnerable carotid plaque. Acta Neurochir (Wien). 152 (4): 589-95.