Quick Order

Text Size:AAA

Human ALK-4 transcript variant 1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ACVR1B cDNA Clone Product Information
RefSeq ORF Size:1518bp
cDNA Description:Full length Clone DNA of Homo sapiens activin A receptor, type I B, transcript variant 1 with Flag tag.
Gene Synonym:ALK4, SKR2, ACTRIB, ACVRLK4
Restriction Site:KpnI + XhoI (5.4kb + 1.57kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Human TGFB1 (LAP) / TGF-beta 1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman ALK-2 / ACVR1 Protein (His & Fc Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human TGFBR2 Protein (His & Fc Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human ALK4 / ACVR1B Protein (His Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human BAMBI / NMA Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Human ATF2 Protein (His & GST Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinRat Cripto / TDGF1 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Rhesus ACVR1B / ALK-4 Protein (Fc Tag)Mouse BAMBI / NMA Protein (Fc Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rhesus TGFBR2 Protein (Fc Tag)Rhesus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Mouse Smad5 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)

ALK-4 (Activin Receptor-Like Kinase 4) or ACVR1B (Activin A Receptor, type 1B), belongs to the protein kinase superfamily, TKL Ser/Thr protein kinase family, and TGFB receptor subfamily. ALK-4/ACVR1B acts as a transducer of activin or activin like ligands signals. Activin binds to either ACVR2A or ACVR2B and then forms a complex with ACVR1B. The known type II activin receptors include ActRII and ActRIIB, while the main type I activin receptor in mammalian cells is ALK-4 (ActRIB). In the presence of activin, type II and type I receptors form complexes whereby the type II receptors activate ALK-4 through phosphorylation. The activated ALK-4, in turn, transduces signals downstream by phosphorylation of its effectors, such as Smads, to regulate gene expression and affect cellular phenotype. ALK-4/ACVR1B is an important regulator of vertebrate development, with roles in mesoderm induction, primitive streak formation, gastrulation, dorsoanterior patterning, and left-right axis determination.

  • Chen Y, et al. (2005) Developmental analysis of activin-like kinase receptor-4 (ALK4) expression in Xenopus laevis. 232(2): 393-8.
  • J. Massagu. (1998) TGF- SIGNAL TRANSDUCTION. Annual Review of Biochemistry. 67: 753-91.
  • Size / Price
    Catalog: HG10583-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions