Quick Order

Human Bruton Tyrosine Kinase / BTK Kinase ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BTK cDNA Clone Product Information
RefSeq ORF Size:1980bp
cDNA Description:Full length Clone DNA of Homo sapiens Bruton agammaglobulinemia tyrosine kinase with Flag tag.
Gene Synonym:AT, ATK, BPK, XLA, IMD1, AGMX1, PSCTK1, MGC126261, MGC126262
Restriction Site:KpnI + XhoI (5.4kb + 2.03kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1899C/T not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells. BTK contains a PH domain which binds phosphatidylinositol(3,4,5)-trisphosphate (PIP3). After binding to PIP3, BTK is induced to phosphorylate phospholipase C, which in turn hydrolyzes PIP2 into two second messagers, IP3 and DAG, which then modulate the activity of downstream proteins during B-cell signaling. Btk is also found implicated in the primary immunodeficiency disease X-linked agammaglobulinemia(Bruton's agammaglobulinemia). BTK played a key role in B-cell maturation as well as mast cell activation through the high-affinity IgE receptor. Patients with X-linked agammaglobulinemia have normal pre-B cell populations in their bone marrow but these B-cells can not mature and enter the circulation.

  • Hashimoto S, et al. (1996) Identification of Bruton's tyrosine kinase (Btk) gene mutations and characterization of the derived proteins in 35 X-linked agammaglobulinemia families: a nationwide study of Btk deficiency in Japan. Blood. 88(2): 561-73.
  • Ohta Y, et al. (1994) Genomic organization and structure of Bruton agammaglobulinemia tyrosine kinase: localization of mutations associated with varied clinical presentations and course in X chromosome-linked agammaglobulinemia. PNAS. 91(19): 9062-6.
  • Smith C, et al. (1994) Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells. The Journal of Immunology. 152(2): 557-65.