After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human RUVBL1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RUVBL1 cDNA Clone Product Information
Gene_bank_ref_id:BC004531
RefSeq ORF Size:1371bp
cDNA Description:Full length Clone DNA of Homo sapiens RuvB-like 1 (E. coli) with N terminal HA tag.
Gene Synonym:RVB1, TIH1, ECP54, TIP49, INO80H, NMP238, PONTIN, TIP49A, Pontin52
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

RUVBL1, also known as RVB1, is a component of the NuA4 histone acetyltransferase complex and belongs to the RuvB family. RUVBL1 is ubiquitously expressed with high expression in heart, skeletal muscle and testis. It possesses single-stranded DNA-stimulated ATPase and ATP-dependent DNA helicase (3' to 5') activity. RUVBL1 is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. RUVBL1 plays an essential role in oncogenic transformation by MYC and also modulates transcriptional activation by the LEF1/TCF1-CTNNB1 complex. It also is essential for cell proliferation. RUVBL1 may be able to bind plasminogen at cell surface and enhance plasminogen activation.

References
  • Bauer A, et al. (1998) Pontin52, an interaction partner of beta-catenin, binds to the TATA box binding protein. Proc Natl Acad Sci. 95(25):14787-92.
  • Ewing, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Puri T, et al. (2007) Dodecameric structure and ATPase activity of the human TIP48/TIP49 complex. J Mol Biol. 366(1):179-92.
  • Size / Price
    Catalog: HG14074-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"