Quick Order

Human PTPN2 transcript variant 1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PTPN2 cDNA Clone Product Information
RefSeq ORF Size:1248bp
cDNA Description:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, non-receptor type 2, transcript variant 1 with Flag tag.
Restriction Site:HindIII + XhoI (5.4kb + 1.3kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Tyrosine-protein phosphatase non-receptor type 2, also known as T-cell protein-tyrosine phosphatase, PTPN2 and PTPT, is a cytoplasm protein which belongs to the protein-tyrosine phosphatase family and Non-receptor class 1 subfamily. Members of the protein tyrosine phosphatase ( PTP ) family share a highly conserved catalytic motif, which is essential for the catalytic activity. TC-PTP / PTPN2 is a cytosolic tyrosine phosphatase that functions as a negative regulator of a variety of tyrosine kinases and other signaling proteins. The expression of TC-PTP / PTPN2 plays a role of tumor suppressor and may modulate response to treatment. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Epidermal growth factor receptor and the adaptor protein Shc were reported to be substrates of this PTP, which suggested the roles in growth factor mediated cell signaling. TC-PTP / PTPN2 is an enzyme that is essential for the proper functioning of the immune system and that participates in the control of cell proliferation, and inflammation. TC-PTP / PTPN2 was identified as a negative regulator of NUP214-ABL1 kinase activity.