After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat EDAR Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EDARcDNA Clone Product Information
cDNA Size:1347
cDNA Description:ORF Clone of Rattus norvegicus ectodysplasin-A receptor DNA.
Gene Synonym:RGD1561714, Edar
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Tumor Necrosis Factor (TNF) & Receptor Related Products
Product nameProduct name
Canine CD40 / TNFRSF5 Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (Fc Tag)Canine CD40 / TNFRSF5 ProteinHuman Fas Ligand / FASLG / CD95L Protein (His Tag)Human 4-1BBL / CD137L Protein (Fc Tag, ECD)Canine CD40L / CD154 / TNFSF5 Protein (Fc Tag)Canine CD40L / CD154 / TNFSF5 ProteinCanine CD40 / TNFRSF5 Protein (His Tag)Human GITR / TNFRSF18 Protein (His Tag, ECD)Canine CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Cynomolgus LTB / TNFSF3 / Lymphotoxin beta Protein (His Tag)Cynomolgus TNFRSF21 / DR6 Protein (His Tag)Cynomolgus TNF-alpha / TNFA ProteinHuman XEDAR / EDA2R Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (ECD, His Tag)Human CD40 / TNFRSF5 Protein (ECD, Fc Tag)Cynomolgus RANKL / OPGL / TNFSF11 Protein (Fc Tag)Human CD27 / TNFRSF7 Protein (His & Fc Tag)Human CD27 / TNFRSF7 Protein (His Tag)Human CD27 / TNFRSF7 Protein (Fc Tag)Human CD153 / CD30L / TNFSF8 Protein (Fc Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His & Fc Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Human BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human BLyS / TNFSF13B / BAFF ProteinHuman BLyS / TNFSF13B / BAFF ProteinHuman DR6 / TNFRSF21 Protein (Fc Tag)Human DR6 / TNFRSF21 Protein (His Tag)Human DR6 / TNFRSF21 ProteinHuman FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Human FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Human DCR3 / TNFRSF6B Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (His Tag)Human TNF-beta / TNFSF1 / Lymphotoxin alpha ProteinHuman Osteoprotegerin / TNFRSF11B Protein (His Tag)Human HVEM / TNFRSF14 Protein (His & Fc Tag)Human HVEM / TNFRSF14 Protein (His Tag)Human TNFSF14 / LIGHT / CD258 Protein (His Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His & Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His Tag)Human TNFSF10 / TRAIL / APO-2L / CD253 ProteinHuman TRAIL R4 / CD264 / TNFRSF10D Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His & Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human TNFRSF12A / FN14 / TWEAKR Protein (Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Human TNFRSF4 / OX40 / CD134 Protein (His & Fc Tag)Human TNFRSF4 / OX40 / CD134 Protein (His Tag)Human RELT / TNFRSF19L Protein (His & Fc Tag)Human RELT / TNFRSF19L Protein (His Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Human TNF-alpha / TNFA ProteinHuman TNFRSF17 / BCMA / CD269 Protein (His & Fc Tag)Canine BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human CD40 / TNFRSF5 Protein (His & Fc Tag)Human CD40 / TNFRSF5 Protein (His Tag)Human CD30 / TNFRSF8 Protein (His & Fc Tag)Human CD30 / TNFRSF8 Protein (His Tag)Human CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 ProteinHuman EDAR / DL Protein (Fc Tag)Human EDAR / DL Protein (His Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 ProteinHuman XEDAR / EDA2R Protein (His Tag)Human TNFRSF13B / TACI / CD267 Protein (His Tag)Human TNFRSF25 / DR3 / TNFRSF12 Protein (Fc Tag)Human NGFR / P75 Protein (Fc Tag)Human NGFR/ P75 Protein (His Tag)Human TNFRSF19 / TROY Protein (Fc Tag)Human TNFRSF19 / TROY Protein (His Tag)Human GITR / TNFRSF18 Protein (Fc Tag)Mouse FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Mouse 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (Fc Tag)Mouse TNFRSF17 / BCMA Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His Tag)Mouse PGLYRP1 / PGRP-S Protein (His Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Mouse TNFRSF19 / TROY Protein (His & Fc Tag)Mouse TNFRSF19 / TROY Protein (His Tag)Mouse TNFSF10 / TRAIL / APO-2L Protein (aa 118-291, His Tag)Mouse DR6 / TNFRSF21 Protein (His Tag)Mouse CD40 / TNFRSF5 Protein (His & Fc Tag)Mouse CD40L / CD154 / TNFSF5 Protein (Fc Tag)Mouse RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Mouse TNF-alpha / TNFA ProteinMouse BAFFR / TNFRSF13C / CD268 Protein (Fc Tag)Mouse XEDAR / EDA2R Protein (Fc Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Mouse TNFRSF4 / OX40 / CD134 Protein (Fc Tag)Mouse CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Mouse TNFSF13 Protein (Fc Tag)Mouse NGFR / P75 Protein (Fc Tag)Mouse NGFR / P75 Protein (His Tag)Rat CD40L / CD154 / TNFSF5 Protein (Fc Tag)Ferret TNF-alpha / TNFA ProteinCanine TNF-alpha / TNFA / TNFSF1A ProteinCanine CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Rat TNF-alpha / TNFA ProteinRat CD153 / CD30L / TNFSF8 Protein (Fc Tag)Rat CD153 / CD30L / TNFSF8 ProteinRat TNFSF15 / TL1A Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (His Tag)Rat TNFRSF17 / BCMA Protein (Fc Tag)Rat TNFRSF11A Protein (Fc Tag)Rat TNFRSF11A Protein (His Tag)Rat CD70 / CD27L / TNFSF7 Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (His Tag)Rat 4-1BBL / CD137L / TNFSF9 Protein (Fc Tag) Rat 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Rat BAFFR / TNFRSF13C Protein (His Tag)Rat LTBR / TNFRSF3 Protein (Fc Tag)Rat LTBR / TNFRSF3 Protein (His Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Rat GITR / TNFRSF18 Protein (Fc Tag)Rat XEDAR / EDA2R Protein (Fc Tag)Rat XEDAR / EDA2R Protein (His Tag)Rat EDAR Protein (Fc Tag)Cynomolgus / Rhesus TNF-alpha / TNFA / TNFSF1A / Cachectin ProteinCynomolgus CD27 / TNFRSF7 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (His Tag)Cynomolgus CD40L / CD154 / TNFSF5 Protein (Fc Tag) Cynomolgus / Rhesus CD40 / TNFRSF5 Protein (Fc Tag)Cynomolgus / Rhesus CD40 / TNFRSF5 Protein (His Tag)Cynomolgus TNFSF10 / TRAIL / APO-2L ProteinCynomolgus TRAIL R4 / CD264 / TNFRSF10D Protein (Fc Tag)Cynomolgus TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Cynomolgus LTBR / TNFRSF3 Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Cynomolgus / Rhesus TNFRSF17 / BCMA Protein (Fc Tag)Cynomolgus HVEM / TNFRSF14 Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (Fc Tag)Cynomolgus EDAR Protein (Fc Tag)Cynomolgus EDAR Protein (His Tag)Cynomolgus Osteoprotegerin / TNFRSF11B Protein (Fc Tag)Cynomolgus BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human TNFRSF11A Protein (Fc Tag)Human TNF-alpha / TNFA Protein (Fc Tag)Human TNFRSF11A Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Cynomolgus OX-40L / TNFSF4 Protein (Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (aa 1-268, 196 Met/Arg, His Tag)

Tumor necrosis factor receptor superfamily member EDAR is a Single-pass type I membrane protein. Edar was expressed reiteratively in signaling centers regulating key steps in morphogenesis. activin signaling from mesenchyme induces the expression of the TNF receptor edar in the epithelial signaling centers, thus making them responsive to Wnt-induced ectodysplasin from the nearby ectoderm. This is the first demonstration of integration of the Wnt, activin, and TNF signaling pathways. Defects in EDAR are a cause of ectodermal dysplasia anhidrotic (EDA), also known ectodermal dysplasia hypohidrotic autosomal recessive (HED). Ectodermal dysplasia defines a heterogeneous group of disorders due to abnormal development of two or more ectodermal structures. EDA is characterized by sparse hair (atrichosis or hypotrichosis), abnormal or missing teeth and the inability to sweat due to the absence of sweat glands.

  • Elomaa O, et al. (2001) Ectodysplasin is released by proteolytic shedding and binds to the EDAR protein. Hum Mol Genet. 10 (9): 953-62.
  • Koppinen P, et al. (2001) Signaling and subcellular localization of the TNF receptor Edar. Exp Cell Res. 269 (2): 180-92.
  • Chassaing N, et al. (2006) Mutations in EDAR account for one-quarter of non-ED1-related hypohidrotic ectodermal dysplasia. Hu. Mutat. 27 (3): 255-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items