After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat BCAM Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BCAMcDNA Clone Product Information
cDNA Size:1875
cDNA Description:ORF Clone of Rattus norvegicus basal cell adhesion molecule DNA.
Gene Synonym:Lu, Bcam
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

The Lutheran (Lu) blood group and basal cell adhesion molecule (BCAM) antigens are both carried by 2 glycoprotein isoforms of the immunoglobulin superfamily representing receptors for the laminin alpha(5) chain. It is a transmembrane receptor with five immunoglobulin-like domains in its extracellular region, and is therefore classified as a member of the immunoglobulin (Ig) gene family. In addition to red blood cells, Lu/BCAM proteins are expressed in endothelial cells of vascular capillaries and in epithelial cells of several tissues. BCAM/LU has a wide tissue distribution with a predominant expression in the basal layer of the epithelium and the endothelium of blood vessel walls. As designated as CD239 recently, BCAM and LU share a significant sequence similarity with the CD146 (MUC18) and CD166, and themselves are adhesion molecules that bind laminin with high affinity. Laminins are found in all basement membranes and are involved in cell differentiation, adhesion, migration, and proliferation. BCAM is upregulated following malignant transformation of some cell types in vivo and in vitro, thus being a candidate molecule involved in tumor progression. In addition, BCAM interacts with integrin in sickle red cells, and thus may potentially play a role in vaso-occlusive episodes.

  • Kikkawa Y, et al. (2005) Review: Lutheran/B-CAM: a laminin receptor on red blood cells and in various tissues. Connect Tissue Res. 46 (4-5): 193-9.
  • El Nemer W, et al. (2007) Endothelial Lu/BCAM glycoproteins are novel ligands for red blood cell alpha4beta1 integrin: role in adhesion of sickle red blood cells to endothelial cells. Blood. 109 (8): 3544-51.
  • Colin Y, et al. (2008) Red cell and endothelial Lu/BCAM beyond sickle cell disease. Transfus Clin Biol. 15 (6): 402-5.
  • El Nemer W, et al. (2008) Role of Lu/BCAM in abnormal adhesion of sickle red blood cells to vascular endothelium. Transfus Clin Biol. 15 (1-2): 29-33.