Quick Order

Rat CADM3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CADM3cDNA Clone Product Information
cDNA Size:1191
cDNA Description:ORF Clone of Rattus norvegicus cell adhesion molecule 3 DNA.
Gene Synonym:Igsf4b, Necl-1, Cadm3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Cell Adhesion Molecules (CAMs) are proteins located on the cell surface involved with the binding with other cells or with the extracellular matrix (ECM) in the process called cell adhesion. These proteins are typically transmembrane receptors and are composed of three domains: an intracellular domain that interacts with the cytoskeleton, a transmembrane domain, and an extracellular domain that interacts either with other CAMs of the same kind (homophilic binding) or with other CAMs or the extracellular matrix (heterophilic binding). Cell adhesion molecule 3, also known as Immunoglobulin superfamily member 4B, CADM3, and NECL1, is a neural tissue-specific immunoglobulin-like cell-cell adhesion molecule which has Ca(2+)-independent homo- or heterophilic cell-cell adhesion activity and plays an important role in the formation of synapses, axon bundles and myelinated axons. Isoform 1 of CADM3 is expressed mainly in adult and fetal brain. Isoform 2 of CADM3 is highly expressed in adult brain and weakly expressed in placenta. In brain, Isoform 2 is highly expressed in cerebellum. CADM3 is involved in the cell-cell adhesion. It has both calcium-independent homophilic cell-cell adhesion activity and calcium-independent heterophilic cell-cell adhesion activity with IGSF4, PVRL1 and PVRL3. The interaction with EPB41L1 may regulate structure or function of cell-cell junctions. CADM3 may act as a tumor suppressor in glioma and loss of it in glioma may be caused by histone deacetylation.

  • Dong X, et al. (2006) Crystal structure of the V domain of human Nectin-like molecule-1/Syncam3/Tsll1/Igsf4b, a neural tissue-specific immunoglobulin-like cell-cell adhesion molecule. J Biol Chem. 281(15): 10610-7.
  • Gao J, et al. (2008) Nectin-like molecule 1 is a glycoprotein with a single N-glycosylation site at N290KS which influences its adhesion activity. Biochim Biophys Acta. 1778(6): 1429-35.
  • Gao J, et al. (2009) Loss of NECL1, a novel tumor suppressor, can be restored in glioma by HDAC inhibitor-Trichostatin A through Sp1 binding site. Glia. 57(9): 989-99.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items