Quick Order

Rat CLEC4F ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CLEC4F cDNA Clone Product Information
Gene_bank_ref_id:NM_053753.1
RefSeq ORF Size:1653bp
cDNA Description:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 4, member F with N terminal Flag tag.
Gene Synonym:Kclr, Clecsf13, MGC112607, Clec4f
Species:Rat
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

CLEC4F, a member of C-type lectins, was firstly purified from rat liver extract with high binding affinity to fucose, galactose and N-acetylgalactosamine, and un-sialylated glucosphingolipids with GalNAc or Gal terminus. However, the biological functions of CLEC4F have not been elucidated. Histochemical staining showed that mouse CLEC4F(mCLEC4F) is only expressed on F4/80+ cells localized in liver, and is undetectable in bone marrow, spleen, lymph nodes, or other tissues in adult mice. However, mCLEC4F is detected in the liver of embryonic day 11.5 (E11.5), which is 1.5 day earlier than the formation of liver (E10) and is 3.5 day earlier than the formation of bone marrow (E15-16). Moreover, recombinant mCLEC4F.Fc binds to alpha-galactoceramide in a Ca++-dependent manner, and both galactose and ceramide can partially inhibit CLEC4F.Fc binding to alpha-galactoceramide. Interestingly, mCLEC4F-deficient (mCEC4F k/o) mice produced far less cytokines than wild type littermates after intravenous injection ofalpha-galactoceramide. This suggests that mCLEC4F is not only a specific marker for Kupffer cells, but is also critical for the presentation of glycolipid antigen to NKT cells.

References
  • Shie-Liang Edmond Hsieh, et al. (2009) CLEC4F, A Kupffer Cells Specific Marker, Is Critical for Presentation of Alfa-Galactoceromide to NKT Cells. The Journal of Immunology. 182:78.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 2004 Jan;36(1):40-5.
  • Bonaldo MF, et al. (1996) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res. 1996 Sep;6(9):791-806.
  • Size / Price
    Catalog: RG80215-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"