After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat CLEC14A Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC14AcDNA Clone Product Information
cDNA Size:1407
cDNA Description:ORF Clone of Rattus norvegicus C-type lectin domain family 14, member A DNA.
Gene Synonym:RGD1306232, Clec14a
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

C-type lectin domain family 14 member A, also known as Epidermal growth factor receptor 5 and CLEC14A, is a member of the C-type lectin domain (CTLD) family that contains one c-type lectin domain and one EGF-like domain. Mouse CLEC14A is a 459 amino acid single-pass type I membrane protein. The superfamily of proteins containing C-type lectin-like domains (CTLDs) is a large group of extracellular Metazoan proteins with diverse functions. The CTLD structure has a characteristic double-loop ('loop-in-a-loop') stabilized by two highly conserved disulfide bridges located at the bases of the loops, as well as a set of conserved hydrophobic and polar interactions. Members of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily share a common fold and are involved in a variety of functions, such as generalized defense mechanisms against foreign agents, discrimination between healthy and pathogen-infected cells, and endocytosis and blood coagulation. Genome-level studies on human, elegans and melanogaster demonstrated almost complete divergence among invertebrate and mammalian families of CTLD-containing proteins (CTLDcps). The vertebrate CTLDcp families were essentially formed early in vertebrate evolution and are completely different from the invertebrate families. The composition of the CTLDcp superfamily in fish and mammals suggests that large scale duplication events played an important role in the evolution of vertebrates.

  • Ebner S, et al. (2003) Evolutionary analysis reveals collective properties and specificity in the C-type lectin and lectin-like domain superfamily. Proteins. 53(1): 44-55.
  • Zelensky AN, et al. (2005) The C-type lectin-like domain superfamily. Gready JE. FEBS J. 272(24): 6179-217.