Quick Order

Mouse EGFL7 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EGFL7cDNA Clone Product Information
cDNA Size:825
cDNA Description:ORF Clone of Mus musculus EGF-like domain 7 DNA.
Gene Synonym:Zneu1, VE-statin, Egfl7
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Epidermal Growth Factor (EGF) & Receptor Related Products
Product nameProduct name
Canine NRG1-alpha Protein (ECD, Fc Tag)Human TGFA / TGF-alpha ProteinHuman NRG1 Protein (His Tag, ECD)Canine NRG1-alpha Protein (ECD)Mouse EGFL6 / EGF-L6 Protein (His Tag)Mouse EGFL6 / EGF-L6 Protein (Fc Tag)Human TMEFF1 / Tomoregulin-1 Protein (Fc Tag, ECD)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, Fc Tag)Human HER2 / ErbB2 ProteinMouse EGF / Epidermal growth factor Protein (His Tag)Rhesus HER3 / ErbB3 ProteinHuman HER3 / ErbB3 ProteinRhesus EGFR / HER1 / ErbB1 Protein (ECD, His Tag)Cynomolgus / Rhesus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Human NRG1 Protein (Fc Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human HBEGF / DTR ProteinHuman / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human EGF / Epidermal Growth Factor Protein (Fc Tag)Human EGF / Epidermal Growth Factor ProteinHuman Epiregulin / EREG Protein (Fc Tag) Human EGFL6 / EGF-L6 Protein (His Tag)Cynomolgus HER2 / ErbB2 Protein (His Tag)Human NRG1-beta 1 Protein (EGF Domain, Fc Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG4 ProteinHuman BTC / Betacellulin Protein (Fc Tag)Human BTC / Betacellulin ProteinHuman NRG1-alpha Protein (EGF Domain, Fc Tag)Human NRG1-alpha Protein (ECD, Fc Tag)Human NRG1-alpha Protein (ECD, His Tag)Mouse BTC / Betacellulin Protein (His & Fc Tag)Mouse EGFL7 / VE-statin Protein (His Tag)Mouse EGF / Epidermal Growth Factor Protein (Fc Tag)Mouse EGF / Epidermal Growth Factor ProteinMouse EGF / Epidermal Growth Factor ProteinMouse LRIG1 / LIG-1 Protein (His Tag)Mouse Epiregulin / EREG Protein (Fc Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Canine HER2 / ErbB2 Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Mouse HER4 / ErbB4 Protein (His Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Canine EGF / Epidermal Growth Facto Protein (His Tag)Rat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rat HER2 / ErbB2 ProteinRat EGFR / HER1 / ErbB1 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Cynomolgus BTC / Betacellulin Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Rhesus EGFR / HER1 / ErbB1 Protein (His Tag, ECD)Mouse TMEFF1 / Tomoregulin-1 Protein (Fc Tag)Rat EGF / Epidermal Growth Factor ProteinCanine NRG1 Protein (His Tag)Rat HER4 / ErbB4 Protein (His Tag)Canine NRG1-alpha Protein (EGF Domain, Fc Tag)Canine NRG1-alpha Protein (ECD, His Tag)

Epidermal growth factor-like protein 7, also known as EGF-like protein 7, Multiple epidermal growth factor-like domains protein 7, Multiple EGF-like domains protein 7, Vascular endothelial statin, NOTCH4-like protein and EGFL7, is a secreted protein which contains two EGF-like domains and one EMI domain. EGFL7 was identified by a number of groups as a putative secreted factor produced by the vascular endothelial cells (ECs). EGFL7 is described as a novel endothelial cell-derived factor involved in the regulation of the spatial arrangement of cells during vascular tube assembly. With its impact on tubulogenesis and vessel shape EGFL7 joined the large family of molecules governing blood vessel formation. EGFL7 regulates midline angioblast migration in zebrafish embryos-a key step in vascular tubulogenesis. EGFL7 is tightly associated with the extracellular matrix (ECM), and it supports EC migration either as a single factor or in combination with other ECM molecules. EGFL7 provides a proper microenvironment for endothelial cell migration, thereby enabling accurate patterning. Our study indicates that the molecular composition of the ECM influences vascular morphogenesis. EGFL7 also regulates vascular tubulogenesis. It inhibits platelet-derived growth factor (PDGF)-BB-induced smooth muscle cell migration and promotes endothelial cells adhesion to the substrate.

  • Fitch,M.J. et al., 2004, Dev Dyn. 230 (2):316-24.
  • Schmidt,M. et al., 2007, Novartis Found Symp. 283 :18-28.
  • Campagnolo,L.et al., 2008, Gene Expr Patterns  8 (6):389-96.
  • Picuric,S. et al., 2009, Protein Expr Purif. 68 (1):1-6.
  • Nikolic,I. et al., 2010, J Angiogenes Res. 2 (1): 9. 
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items