After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse ANXA6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ANXA6cDNA Clone Product Information
Gene_bank_ref_id:NM_001110211.1
cDNA Size:2022
cDNA Description:ORF Clone of Mus musculus annexin A6 DNA.
Gene Synonym:Anx6, Cabm, Camb, AnxVI, AW107198
Species:Mouse
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

Annexin A6, also known as ANXA6 or ANXAⅥ, belongs to a family of Ca2+-dependent membrane and phospholipid binding proteins. Members of this family have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 6 is phosphorylated in vivo associated with cell growth. Annexin 6 was not phosphorylated in quiescent cells, but was phosphorylated on serine and to a lesser extent threonine, several hours following cell stimulation. Experiment has revealed the presence of annexin A6 on the cell surface of variety cells as putative receptors and / or binding proteins for chondroitin sulfate proteoglycans, helping cells to bind with this extracellular matrix glycosaminoglycan chondroitin sulfate which is related to the cell-substratum adhesion. A post-tranlational modification other than direct protein phosphorylation may influence the activity of annexin6 and provide evidence linking cell growth with regulation of annexin 6 function. 

References
  • Takagi H, et al. (2002) Annexin 6 is a putative cell surface receptor for chondroitin sulfate chains. J Cell Sci. 115 (16): 3309-18.
  • Moss SE, et al. (1992) A growth-dependent post-translational modification of annexin VI. Biochim Biophys Acta. 1160 (1): 120-6.
  • Song G, et al. (1998) Altered cardiac annexin mRNA and protein levels in the left ventricle of patients with end-stage heart failure. J Mol Cell Cardio. 30 (3): 443-51.
  • Size / Price
    Catalog:MG52219-CF
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"