After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human MMP-1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MMP1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human MMP1 Gene Expression validated Image
[Click to enlarge image]
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human MMP-1 natural ORF mammalian expression plasmid, Flag tag
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

MMP1, also known as MMP-1, contains 4 hemopexin-like domains and is a member of the matrix metalloproteinase (MMP) family. Matrix metalloproteases, also called matrixins, are zinc-dependent endopeptidases that are the major proteases involved in ECM degradation. MMPs are capable of degrading a wide range of extracellular molecules and a number of bioactive molecules. MMP activity is regulated by two major endogenous inhibitors: alpha2-macroglobulin and tissue inhibitors of metalloproteases (TIMPs). MMPs play a central role in cell proliferation, migration, differentiation, angiogenesis, apoptosis and host defences. Dysregulatoin of MMPs has been implicated in many diseases including arthritis, chronic ulcers, encephalomyelitis and cancer. Tumour metastasis is a multistep process involving the dessemination of tumor cells from the primary tumor to secondarys at a distant organ or tissue. One of the first steps in metastasis is the degradation of the basement membrane, a process in which MMPs have been implicated. MMPs are secreted by tumor cells themselves or by surrounding stromal cells stimulated by the nearby tumor. Numerous studies have linked altered MMP expression in different human cancers with poor disease prognosis. MMP-1, -2, -3, -7, -9, -13 and -14 all have elevated expression in primary tumors and/or metastases. MMP-1 cleaves collagens of types I, II, and III at one site in the helical domain. It also cleaves collagens of types VII and X. In case of HIV infection, MMP1 interacts and cleaves the secreted viral Tat protein, leading to a decrease in neuronal Tat's mediated neurotoxicity.

  • Gross J, et al. (1962) Collagenolytic Activity in Amphibian Tissues: A Tissue Culture Assay. Proceedings of the National Academy of Sciences. 48(6):1014-22.
  • Pendas, et al. (1996) Fine Physical Mapping of the Human Matrix Metalloproteinase Genes Clustered on Chromosome 11q22.3. Genomics. 37(2):266-8.
  • Brinckerhoff C E, et al. (1987) Molecular cloning of human synovial cell collagenase and selection of a single gene from genomic DNA. Journal of Clinical Investigation. 79(2):542-6.