Quick Order

Text Size:AAA

Human SPG21 transcript variant 1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SPG21 cDNA Clone Product Information
RefSeq ORF Size:927bp
cDNA Description:Full length Clone DNA of Homo sapiens spastic paraplegia 21 (autosomal recessive, Mast syndrome), transcript variant 1 with Flag tag.
Gene Synonym:MAST, ACP33, GL010, BM-019, MASPARDIN
Restriction Site:KpnI + XbaI (5.4kb + 0.98kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Spastic paraplegia 21 (SPG21), also known as acid Cluster Protein 33 (ACP33) and Mast syndrome protein, is a member of the AB hydrolase superfamily. Human SPG21 is a 308 amino acid residue protein widely expressed in all tissues, including heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. SPG21 binds to the hydrophobic C-terminal amino acids of CD4 which are involved in repression of T cell activation via the noncatalytic alpha/beta hydrolase fold domain. SPG21 thus is proposed to play a role as a negative regulatory factor in CD4-dependent T-cell activation of CD4. Defects in SPG21 are the cause of spastic paraplegia autosomal recessive type 21, also known as Mast syndrome, a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. SPG21 is also associated with dementia and other central nervous system abnormalities.

  • Zeitlmann L. et al., 2001, J Biol Chem. 276: 9123-32.
  • Simpson M. A. et al., 2003, Am J Hum Genet. 73: 1147-156.
  • Ota T. et al., 2004, Nat. Genet.36: 40-45.
  • Kedmi M. et al., 2007, Physiol Genomics. 28: 213-22.
  • Hanna M. C. et al., 2009, Neurogenetics.10: 217-28.
  • Size / Price
    Catalog: HG10522-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions