Quick Order

Text Size:AAA

Human MMP-3 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MMP3 cDNA Clone Product Information
RefSeq ORF Size:1434bp
cDNA Description:Full length Clone DNA of Homo sapiens matrix metallopeptidase 3 (stromelysin 1, progelatinase) with Flag tag.
Gene Synonym:SL-1, STMY, STR1, MMP-3, STMY1, MGC126102, MGC126103, MGC126104, MMP3
Restriction Site:KpnI (two restriction sites) + XhoI (5.4kb + 0.83kb + 0.65kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for four point mutations: 288T/C,306C/G and 1086T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Matrix metallopeptidase 3 (abbreviated as MMP3) is also known as stromelysin 1 and progelatinase. MMP3 is a member of the matrix metalloproteinase (MMP) family whose members are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, tissue remodeling, and disease processes including arthritis and metastasis. As a secreted zinc-dependent endopeptidase, MMP3 exerts its functions mainly in extracellular matrix. This protein is activated by two major endogenous inhibitors: alpha2-macroglobulin and tissue inhibitors of metalloproteases (TIMPs). MMP3 plays a central role in degrading collagen types II, III, IV, IX, and X, proteoglycans, fibronectin, laminin, and elastin. In addition, MMP3 can also active other MMPs such as MMP1, MMP7, and MMP9, rendering MMP3 crucial in connective tissue remodeling. Dysregulatoin of MMPs has been implicated in many diseases including arthritis, chronic ulcers, encephalomyelitis and cancer. Synthetic or natural inhibitors of MMPs result in inhibition of metastasis, while up-regulation of MMPs led to enhanced cancer cell invasion.

  • Sternlicht MD, et al. 1999, The stromal proteinase MMP3/stromelysin-1 promotes mammary carcinogenesis. Cell. 98(2): 137-46.
  • Yoon S, et al. (1999) Genetic analysis of MMP3, MMP9, and PAI-1 in Finnish patients with abdominal aortic or intracranial aneurysms. Biochem Biophys Res Commun. 265(2): 563-8.
  • Biondi ML, et al. (2000) MMP1 and MMP3 polymorphisms in promoter regions and cancer. Clin Chem. 46(12): 2023-4.
  • Size / Price
    Catalog: HG10467-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions