Quick Order

Human CystatinB ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CSTB cDNA Clone Product Information
RefSeq ORF Size:297bp
cDNA Description:Full length Clone DNA of Homo sapiens cystatin B (stefin B) with Flag tag.
Gene Synonym:PME, CST6, EPM1, STFB, CSTB
Restriction Site:KpnI + XhoI (5.4kb + 0.35kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Cystatin-B, also known as CPI-B, Liver thiol proteinase inhibitor, Stefin-B, CSTB and CST6, is a cytoplasm and nucleus protein which belongs to the cystatin family. Cystatin-B / CSTB is an intracellular thiol proteinase inhibitor. Tightly binding reversible inhibitor of cathepsins L, H and B. Cystatin-B / CSTB is able to form a dimer stabilized by noncovalent forces, inhibiting papain and cathepsins l, h and b. Cystatin-B / CSTB is also thought to play a role in protecting against the proteases leaking from lysosomes. Defects in Cystatin-B / CSTB are the cause of progressive myoclonic epilepsy type 1 (EPM1) which is an autosomal recessive disorder characterized by severe, stimulus-sensitive myoclonus and tonic-clonic seizures. The cystatins are a family of cysteine protease inhibitors with homology to chicken cystatin. Cystatins are physiological inhibitors of cysteine proteinases which are widely distributed in human tissues and fluids. Cystatins typically comprise about 115 amino acids, are largely acidic, contain four conserved cysteine residues known to form two disulfide bonds. Cystatins may be glycosylated and / or phosphorylated, with similarity to fetuins, kininogens, stefins, histidine-rich glycoproteins and cystatin-related proteins. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired inhibitory activity. Cystatins mainly inhibit peptidases belonging to peptidase families C1 (papain family) and C13 (legumain family).

Size / Price
Catalog: HG10435-M-F
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions