Quick Order

Text Size:AAA

Human TIMP2 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TIMP2 cDNA Clone Product Information
RefSeq ORF Size:663bp
cDNA Description:Full length Clone DNA of Homo sapiens TIMP metallopeptidase inhibitor 2 (TIMP2) with Flag tag.
Gene Synonym:CSC-21K, TIMP2
Restriction Site:HindIII + XhoI (5.4kb + 0.71kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Tissue inhibitors of metalloproteinases (TIMP) family are natural inhibitors of the matrix metalloproteinases (MMPs), the zinc enzymes involved in extracellular matrix maintenance and remodeling. The TIMP family encompasses four members (TIMP1-4), and they inhibit most MMPs by forming non-covalent binary complex. TIMP2 is a 22 kDa non N-glycosylated protein expressed by a variety of cell types, and plays a unique role among TIMP family members owing to its functions to regulate cellular responses to growth factors. Findings establish an unexpected, MMP-independent mechanism for TIMP2 inhibition of endothelial cell proliferation in vitro and reveal an important component of the antiangiogenic effect of TIMP2 in vivo. TIMP-2 thus is critical to the maintenance of tissue homeostasis and is involved in the regulation of tumor microenvironment.

  • Stetler-Stevenson, W.G. et al., 1992, Matrix. Suppl.1: 299-306.
  • Stetler-Stevenson, W.G. et al., 2005, Trends. Mol. Med. 11: 97-103.
  • Seo, D.W. et al., 2003, Cell. 114: 171-180.
  • Size / Price
    Catalog: HG10396-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions