After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PGDcDNA Clone Product Information
Gene_bank_ref_id:NM_002631.2
cDNA Size:1452
cDNA Description:ORF Clone of Homo sapiens phosphogluconate dehydrogenase DNA.
Gene Synonym:6PGD, PGD
Species:Human
Vector:pCMV2-FLAG
Restriction Site:HindIII + XhoI
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged on other vectors
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10393-ACG$325
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10393-ACR$325
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10393-ANG$325
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10393-ANR$325
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10393-CF$295
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10393-CH$295
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10393-CM$295
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10393-CY$295
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone)HG10393-M$95
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10393-M-F$295
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10393-M-N$295
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10393-NF$295
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10393-NH$295
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10393-NM$295
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10393-NY$295
Human PTGDS / PGD Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10393-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
References
  • Baillet A, et al. (2011) Coupling of 6-phosphogluconate dehydrogenase with NADPH oxidase in neutrophils: Nox2 activity regulation by NADPH availability. FASEB J. 25(7): 2333-43.
  • Rho HK, et al. (2005) Transcriptional regulation of mouse 6-phosphogluconate dehydrogenase by ADD1/SREBP1c. Biochem Biophys Res Commun. 332(1): 288-96.
  • Broedel SE, et al. (1990). Genetic tagging, cloning, and DNA sequence of the Synechococcus sp. strain PCC 7942 gene (gnd) encoding 6-phosphogluconate dehydrogenase. J Bacteriol. 172 (7): 4023-31.
  • Adams MJ, et al. (1983). The three dimensional structure of sheep liver 6-phosphogluconate dehydrogenase at 2.6 A resolution. EMBO J. 2 (6): 1009-14.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"