After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse MAP2K2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAP2K2cDNA Clone Product Information
cDNA Size:1206
cDNA Description:ORF Clone of Mus musculus mitogen-activated protein kinase kinase 2 DNA.
Gene Synonym:MK2, MEK2, Prkmk2, AA589381
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Dual specificity mitogen-activated protein kinase kinase 2, also known as MAP kinase kinase 2, MAPKK2, ERK activator kinase 2, MAPK / ERK kinase 2, MEK2 and MAP2K2, is a member of the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase subfamily. MAP2K2 / MEK2 contains one protein kinase domain. MEK1 and MEK2 (also known as MAP2K1 and MAP2K2, respectively) are evolutionarily conserved, dual-specificity kinases that mediate Erk1 and Erk2 activation during adhesion and growth factor signaling. MAP2K1 / MEK1 is a crucial modulator of Mek and Erk signaling and have potential implications for the role of MEK1 and MEK2 in tumorigenesis. MAP2K2 / MEK2 catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases. It also activates the ERK1 and ERK2 MAP kinases. Defects in MAP2K2 are a cause of cardiofaciocutaneous syndrome (CFC syndrome) which is characterized by a distinctive facial appearance, heart defects and mental retardation. Heart defects include pulmonic stenosis, atrial septal defects and hypertrophic cardiomyopathy.

  • MacDonald,T.J. et al., 2001, Nat Genet. 29 (2):143-52.
  • Mittal R., et al., 2006, Proc. Natl. Acad. Sci. USA. 103:18574-9.
  • Narumi,Y. et al., 2007, Am J Med Genet A. 143A (8):799-807.
  • Daub H., et al., 2008, Mol. Cell 31:438-448.
  • Catalanotti,F. et al., 2009, Nat Struct Mol Biol. 16 (3):294-303.