Quick Order

Text Size:AAA

Human DCUN1D1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DCUN1D1 cDNA Clone Product Information
Gene_bank_ref_id:BC009478
RefSeq ORF Size:780bp
cDNA Description:Full length Clone DNA of Homo sapiens DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) with C terminal HA tag.
Gene Synonym:RP42, SCRO, Tes3, DCNL1, SCCRO, DCUN1L1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

DCUN1D1, also known as SCCRO, is part of an E3 ubiquitin ligase complex for neddylation. DCUN1D1 functions to recruit charged E2 and is involved in the release of inhibitory effects of CAND1 on cullin-RING ligase E3 complex assembly and activity. DCUN1D1 binds to the components of the neddylation pathway (Cullin-ROC1, Ubc12, and CAND1) and augments but is not required for cullin neddylation in reactions using purified recombinant proteins. DCUN1D1 also recruits Ubc12 approximately NEDD8 to the CAND1-Cul1-ROC1 complex but that this is not sufficient to dissociate or overcome the inhibitory effects of CAND1 on cullin neddylation in purified protein assays. DCUN1D1 also acts as am ncogene facilitating malignant transformation and carcinogenic progression.

References
  • Heir P. et al., 2013, Mol Cell Biol. 33 (8): 1621-31.
  • Kurz T. et al., 2005, Nature. 435 (7046): 1257-61.
  • Kim AY. et al., 2008, J Biol Chem. 283 (48): 33211-20.
  • Size / Price
    Catalog: HG15059-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"