Quick Order

Text Size:AAA

Human CKMT1A ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CKMT1A cDNA Clone Product Information
Gene_bank_ref_id:BC001926
RefSeq ORF Size:1254bp
cDNA Description:Full length Clone DNA of Homo sapiens creatine kinase, mitochondrial 1A with N terminal HA tag.
Gene Synonym:CKMT1
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CKMT1A belongs to the ATP:guanido phosphotransferase family. It contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. CKMT1A gene is one of two genes which encode the ubiquitous mitochondrial creatine kinase (CKMT1). CKMT1 is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK (CKMT2) and ubiquitous MtCK, encoded by separate genes. CKMT1 occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Ubiquitous mitochondrial creatine kinase has 80% homology with the coding exons of sarcomeric CKMT1.

References
  • Haas RC, et al. (1989) Isolation and characterization of the gene and cDNA encoding human mitochondrial creatine kinase. J Biol Chem. 264(5):2890-7.
  • Stachowiak O, et al. (1998) Oligomeric state and membrane binding behaviour of creatine kinase isoenzymes: implications for cellular function and mitochondrial structure. Mol Cell Biochem. 184(1-2):141-51.
  • Lipskaya TY. (2001) Mitochondrial creatine kinase: properties and function. Biochemistry Mosc. 66(10):1098-111.
  • Size / Price
    Catalog: HG13924-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"