After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SLPI Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SLPIcDNA Clone Product Information
cDNA Size:399
cDNA Description:ORF Clone of Homo sapiens secretory leukocyte peptidase inhibitor DNA.
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human SLPI Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged on other vectors
Related Products
Product nameProduct name

Secretory leukoprotease inhibitor (SLPI), also called antileukoprotease (ALP), is a 12-kDa, nonglycosylated serine protease inhibitor present in mucous secretions. It is thought to play a role in protecting the mucosae from injury associated with inflammation. SLPI is locally produced by serous cells, including bronchial submucosal glands. Elafin and SLPI are members of larger families of proteins secreted predominantly at mucosal sites, and have been shown to be modulated in multiple pathological conditions. Elafin and SLPI are structurally related in that both have a fold with a four-disulfide core or whey acidic protein (WAP) domain responsible for inhibiting proteases. SLPI is a prominent innate immune protein of the respiratory tract, possessing serine protease inhibitor activity, antibacterial activity, and anti-inflammatory/immunomodulatory activity.

  • Moreau T, et al. (2008) Multifaceted roles of human elafin and secretory leukocyte proteinase inhibitor (SLPI), two serine protease inhibitors of the chelonianin family. Biochimie. 90(2): 284-95.
  • Weldon S, et al. (2007) Innate host defense functions of secretory leucoprotease inhibitor. Exp Lung Res. 33(10): 485-91.
  • Williams SE, et al. (2006) SLPI and elafin: one glove, many fingers. Clin Sci (Lond). 110(1): 21-35.
  • Kikuchi T, et al. (1996) Regulation of secretory leukoprotease inhibitor gene expression. Nihon Rinsho. 54(2): 405-10.