After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MVK Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MVKcDNA Clone Product Information
cDNA Size:1191
cDNA Description:ORF Clone of Homo sapiens mevalonate kinase DNA.
Gene Synonym:MK, LRBP, MVLK, POROK3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Mevalonate kinase belongs to the GHMP kinase family, Mevalonate kinase subfamily. It can be found in a wide variety of organisms from bacteria to mammals. Mevalonate kinase may be a regulatory site in cholesterol biosynthetic pathway. Defects in mevalonate kinase can cause mevalonic aciduria (MEVA). It is an accumulation of mevalonic acid which causes a variety of symptoms such as psychomotor retardation, dysmorphic features, cataracts, hepatosplenomegaly, lymphadenopathy, anemia, hypotonia, myopathy, and ataxia. Defects in mevalonate kinase can also cause hyperimmunoglobulinemia D and periodic fever syndrome (HIDS). HIDS is an autosomal recessive disease characterized by recurrent episodes of unexplained high fever associated with skin rash, diarrhea, adenopathy (swollen, tender lymph nodes), athralgias and/or arthritis.

  • Fu Z, et al. (2008) Biochemical and structural basis for feedback inhibition of Mevalonate kinase and isoprenoid metabolism. Biochemistry. 47(12):3715-24.
  • Houten SM, et al. (2000) Biochemical and genetic aspects of Mevalonate kinase and its deficiency. Biochim Biophys Acta. 1529(1-3):19-32.
  • Schafer BL, et al. (1992) Molecular cloning of human Mevalonate kinase and identification of a missense mutation in the genetic disease mevalonic aciduria. J Biol Chem. 267(19): 13229-38.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks