Quick Order

Text Size:AAA

Human IFNαG Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IFNA5cDNA Clone Product Information
cDNA Size:570
cDNA Description:ORF Clone of Homo sapiens interferon, alpha 5 DNA.
Gene Synonym:IFNA5, RP11-380P16.5
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Interferon & Receptor Related Products
Product nameProduct name
Mouse IFNA2 / Interferon alpha 2 ProteinCynomolgus IFNAR1 / IFNAR ProteinCynomolgus / Rhesus IFNA2 / Interferon alpha 2 ProteinHuman IL29 / IFNL1 ProteinCynomolgus IFNAR2 / IFNABR Protein (ECD, His Tag)Human Interferon alpha 2 / IFNA2 ProteinMouse IL-28B / IFN-lambda-3 Protein (His Tag)Cynomolgus / Rhesus IFNG / Interferon Gamma ProteinHuman IFNα4 / IFNa4 / Interferon alpha-4 Protein (Fc Tag)Human IFNα4 / IFNa4 / Interferon alpha-4 Protein (His Tag)Human IFNGR1 / CD119 Protein (His & Fc Tag)Human IFNGR1 / CD119 Protein (His Tag)Human Interferon alpha 7 / IFNA7 Protein (Fc Tag)Human IFNA5 / IFNaG / Interferon alpha-G Protein (Fc Tag)Human Interferon alpha-B / IFNA8 ProteinHuman Interferon alpha 10 / IFNA10 Protein (Fc Tag)Human Interferon omega-1 / IFNω / IFNW1 Protein (Fc Tag)Human IFN omega 1 / IFNW1 Protein (His Tag)Human IFNAR2 / IFNABR Protein (Fc Tag)Human IFNAR2 / IFNABR Protein (His Tag)Human Interferon beta / IFN-beta / IFNB Protein (Fc Tag)Human Interferon beta / IFN-beta / IFNB ProteinHuman Interferon alpha-B / IFNA8 Protein (His Tag)Human IFN-gamma / IFNG / γ-IFN ProteinHuman IFNL3 / IL28B / Interleukin-28B Protein (His Tag)Human IL-29 / Interleukin-29 Protein (His Tag)Mouse IFNA5 / IFNaG Protein (His Tag)Human IFNAR1 / IFNAR Protein (Fc Tag)Human IFNAR1 / IFNAR Protein (His Tag)Mouse IFNAR1 / IFNAR Protein (His Tag)Mouse IFNA2 / Interferon alpha 2 Protein (Fc Tag)Mouse IFNA5 / IFNaG Protein (Fc Tag)Mouse IFNG / Interferon Gamma ProteinMouse IFNGR2 Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (Fc Tag)Mouse IFNA4 / Interferon alpha-4 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (His Tag)Mouse IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Mouse IFNB1 / IFN-beta / Interferon beta ProteinMouse IFNG / Interferon Gamma Protein (Fc Tag)Mouse IFNG / Interferon Gamma Protein (His Tag)Cynomolgus / Rhesus IFNA14 / Interferon alpha-14 Protein (His Tag)Ferret IFNG / Interferon Gamma Protein (His Tag)Rat IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (His Tag)Rat IFNGR / IFNGR1 Protein (Fc Tag)Rat IFNA5 / IFNaG Protein (His Tag)Rat IFNG / Interferon Gamma Protein (Fc Tag)Cynomolgus IFNA2 / Interferon alpha 2 Protein (Fc Tag)Cynomolgus IFNA2 / Interferon alpha 2 Protein (His Tag)Cynomolgus Interferon alpha-B / IFNA8 Protein (Fc Tag)Cynomolgus Interferon alpha-B / IFNA8 Protein (His Tag)Cynomolgus IFNA13 / Interferon alpha-13 Protein (Fc Tag)Cynomolgus IFNA13 / Interferon alpha-13 Protein (His Tag)Cynomolgus IFNAR1 / IFNAR Protein (His Tag)Cynomolgus IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Cynomolgus IFNGR / IFNGR1 Protein (Fc Tag)Cynomolgus IFNGR / IFNGR1 Protein (His Tag)Cynomolgus IFN gamma Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (His Tag)Cynomolgus IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Cynomolgus IFNAR1 / IFNAR Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (His Tag)Mouse IFNA4 / IFNα4 / Interferon alpha-4 Protein (His Tag)

Interferon, alpha 5 (IFNA5) belongs to the alpha/beta interferon family. IFNA5 is the only IFNA subtype detected in normal liver, while a mixture of subtypes is observed in the liver tissue of patients with chronic hepatitis C. Interferons are produced by macrophages, IFN-alpha have antiviral activities. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. IFN-alpha, the first cytokine to be produced by recombinant DNA technology, has emerged as an important regulator of growth and differentiation, affecting cellular communication and signal transduction pathways as well as immunological control. Originally discovered as an antiviral substance, the efficacy of IFN-alpha in malignant, viral, immunological, angiogenic, inflammatory, and fibrotic diseases suggests a spectrum of interrelated pathophysiologies. IFN-alpha emerged as a prototypic tumor suppressor protein that represses the clinical tumorigenic phenotype in some malignancies capable of differentiation.

  • Lau JY, et al. (1993) Discrepancy between biochemical and virological responses to interferon-alpha in chronic hepatitis C. Lancet. 342(8881): 1208-9.
  • Kessler DS, et al. (1990) Interferon-alpha regulates nuclear translocation and DNA-binding affinity of ISGF3, a multimeric transcriptional activator. Genes Dev. 4(10): 1753-65.
  • Gutterman JU. Cytokine therapeutics: lessons from interferon alpha. Proc Natl Acad Sci U S A. 91(4): 1198-205.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
      Recently Viewed Items