After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DIABLO cDNA Clone Product Information
RefSeq ORF Size:720bp
cDNA Description:Full length Clone DNA of Homo sapiens diablo homolog (Drosophila), nuclear gene encoding mitochondrial protein, transcript variant 1 with Flag tag.
Gene Synonym:SMAC, SMAC3, DIABLO-S, FLJ10537, FLJ25049
Restriction Site:KpnI + XhoI (5.4kb + 0.77kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, Flag tag on other vectors
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, C-GFPSpark tagHG10339-ACG$325
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10339-ACR$325
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, N-GFPSpark tagHG10339-ANG$325
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10339-ANR$325
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, C-Flag tagHG10339-CF$295
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, C-His tagHG10339-CH$295
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, C-Myc tagHG10339-CM$295
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, C-HA tagHG10339-CY$295
Human SMAC / Diablo transcript variant 1 Gene cDNA clone plasmidHG10339-M$95
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, Flag tagHG10339-M-F$295
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, N-Flag tagHG10339-NF$295
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, N-His tagHG10339-NH$295
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, N-Myc tagHG10339-NM$295
Human SMAC / Diablo transcript variant 1 ORF mammalian expression plasmid, N-HA tagHG10339-NY$295
Human SMAC / Diablo transcript variant 1 natural ORF mammalian expression plasmidHG10339-UT$295
 Learn more about expression Vectors
Product nameProduct name

Apoptosis is an essential processes required for normal development and homeostasis of all metazoan organisms. Second Mitochondria-Derived Activator of Caspases (Smac) or Direct IAP Binding Protein with low isoelectric point, pI (Diablo) is a proapoptogenic mitochondrial protein that is released to the cytosol in response to diverse apoptotic stimuli, including commonly used chemotherapeutic drugs. The current knowlege about structure and function of Smac/Diablo during programmed cell death, both in mitochondrial and receptor pathways are presented. It has been shown that Diablo mainly interacts with IAPs in the cytochrome c/Apaf-1/caspase-9 pathway, and promotes apoptosis. Diablo is released from the mitochondria into the cytosol occurring downstream of cytochrome c release in response to apoptotic stimuli such as irradiation, DNA damage or cytotoxic drugs. In the cytosol, Smac/Diablo interacts and antagonizes inhibitors of apoptosis proteins (IAPs), thus allowing the activation of caspases and apoptosis. This activity has prompted the synthesis of peptidomimetics that could potentially be used in cancer therapy. The role of Smac/DIABLO in colorectal carcinogenesis is ill defined. Data continues to accumulate to suggest that decreased levels of Smac/DIABLO may be important in chemoradiation-resistance to apoptosis in advanced colon cancer.

  • Korga A, et al. (2006) Role of mitochondrial protein Smac/Diablo in regulation of apoptotic pathways Pol Merkur Lekarski. 20(119): 573-6.
  • Anguiano-Hernandez YM, et al. (2007) Smac/DIABLO and colon cancer. Anticancer Agents Med Chem. 7(4): 467-73.
  • Martinez-Ruiz G, et al. (2008) Role of Smac/DIABLO in cancer progression. J Exp Clin Cancer Res. 27: 48.
  • Size / Price
    Catalog: HG10339-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions